EMAIL THIS PAGE TO A FRIEND

G6PC3

glucose 6 phosphatase, catalytic, 3

63 Gene Product Result for
Synonyms: SCN4 UGRP
UniProtKB ID: Q9BUM1, Q8WU15
Gene ID:
Human(92579) Summary: This gene encodes the catalytic subunit of glucose-6-phosphatase (G6Pase). G6Pase is located in the endoplasmic reticulum (ER) and catalyzes the hydrolysis of glucose-6-phosphate to glucose and phosphate in the last step of the gluconeogenic and glycogenolytic pathways. Mutations in this gene result in autosomal recessive severe congenital neutropenia. Multiple transcript variants have been found for this gene, only one of which is expected to express a protein.[provided by RefSeq, Sep 2009]
Mouse(68401) glucose 6 phosphatase, catalytic, 3
Rat(303565) glucose 6 phosphatase, catalytic, 3
Zebrafish(790919) glucose 6 phosphatase, catalytic, 3
cow(369023) glucose 6 phosphatase, catalytic, 3
Horse(100064862) glucose 6 phosphatase, catalytic, 3
domestic cat(101097770) glucose 6 phosphatase, catalytic, 3
dog(490942) glucose 6 phosphatase, catalytic, 3
chicken(100859356) glucose 6 phosphatase, catalytic, 3
domestic guinea pig(100723248) glucose 6 phosphatase, catalytic, 3
naked mole-rat(101723886) glucose 6 phosphatase, catalytic, 3
sheep(101113421) glucose 6 phosphatase, catalytic, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067052 Anti-G6PC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138387 Rosetta Predictions human pricing
NM_176077 Rosetta Predictions rat pricing
NM_175935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209810 predicted 515
2 SASI_Hs01_00209812 predicted 387
3 SASI_Hs01_00209815 predicted 1001
4 SASI_Hs01_00209816 predicted 685
5 SASI_Hs01_00209817 predicted 849
6 SASI_Hs02_00363526 predicted 390
7 SASI_Hs01_00209818 predicted 850
8 SASI_Hs01_00209819 predicted 1282
9 SASI_Hs02_00363527 predicted 1223
10 SASI_Hs02_00363528 predicted 782
11 SASI_Hs01_00209811 predicted 879
12 SASI_Hs01_00209813 predicted 804
13 SASI_Hs01_00209814 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044197 predicted 525
2 SASI_Rn01_00044198 predicted 928
3 SASI_Rn01_00044199 predicted 800
4 SASI_Rn02_00269559 predicted 912
5 SASI_Rn01_00044201 predicted 979
6 SASI_Rn01_00044202 predicted 373
7 SASI_Rn01_00044203 predicted 540
8 SASI_Rn01_00044204 predicted 327
9 SASI_Rn01_00044205 predicted 408
10 SASI_Rn01_00044206 predicted 816
11 SASI_Rn01_00044200 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141240 predicted 855
2 SASI_Mm01_00141241 predicted 1134
3 SASI_Mm01_00141242 predicted 734
4 SASI_Mm01_00141243 predicted 1314
5 SASI_Mm01_00141244 predicted 516
6 SASI_Mm01_00141246 predicted 1216
7 SASI_Mm02_00346691 predicted 584
8 SASI_Mm01_00141247 predicted 950
9 SASI_Mm02_00346692 predicted 714
10 SASI_Mm01_00141248 predicted 906
11 SASI_Mm01_00141245 predicted 1301
12 SASI_Mm01_00141249 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175935
VALIDATED
G6PC3 MISSION shRNA Bacterial Glycerol Stock
glucose 6 phosphatase, catalytic, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-1360s1c1
Sequence:CCGGCCGCTCACCTTGAACTTCATTCTCGAGAATGAAGTTCAAGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-584s1c1
Sequence:CCGGCGCAGCTCTTTGGCCTGTAATCTCGAGATTACAGGCCAAAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-322s1c1
Sequence:CCGGTGGGCGATCCTAAGAATCTTTCTCGAGAAAGATTCTTAGGATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-670s1c1
Sequence:CCGGTGGCTTATTGTACCTTCCTATCTCGAGATAGGAAGGTACAATAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175935.3-860s1c1
Sequence:CCGGCCTCATGTATTGGACTCTCTTCTCGAGAAGAGAGTCCAATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-860s21c1
Sequence:CCGGCCTCATGTATTGGACTCTCTTCTCGAGAAGAGAGTCCAATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175935.3-1360s21c1
Sequence:CCGGCCGCTCACCTTGAACTTCATTCTCGAGAATGAAGTTCAAGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-670s21c1
Sequence:CCGGTGGCTTATTGTACCTTCCTATCTCGAGATAGGAAGGTACAATAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-322s21c1
Sequence:CCGGTGGGCGATCCTAAGAATCTTTCTCGAGAAAGATTCTTAGGATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-584s21c1
Sequence:CCGGCGCAGCTCTTTGGCCTGTAATCTCGAGATTACAGGCCAAAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175935
VALIDATED
G6PC3 MISSION shRNA shRNA Plasmid DNA
glucose 6 phosphatase, catalytic, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-1360s1c1
Sequence:CCGGCCGCTCACCTTGAACTTCATTCTCGAGAATGAAGTTCAAGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-584s1c1
Sequence:CCGGCGCAGCTCTTTGGCCTGTAATCTCGAGATTACAGGCCAAAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-322s1c1
Sequence:CCGGTGGGCGATCCTAAGAATCTTTCTCGAGAAAGATTCTTAGGATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-670s1c1
Sequence:CCGGTGGCTTATTGTACCTTCCTATCTCGAGATAGGAAGGTACAATAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175935.3-860s1c1
Sequence:CCGGCCTCATGTATTGGACTCTCTTCTCGAGAAGAGAGTCCAATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-860s21c1
Sequence:CCGGCCTCATGTATTGGACTCTCTTCTCGAGAAGAGAGTCCAATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175935.3-1360s21c1
Sequence:CCGGCCGCTCACCTTGAACTTCATTCTCGAGAATGAAGTTCAAGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-670s21c1
Sequence:CCGGTGGCTTATTGTACCTTCCTATCTCGAGATAGGAAGGTACAATAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-322s21c1
Sequence:CCGGTGGGCGATCCTAAGAATCTTTCTCGAGAAAGATTCTTAGGATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-584s21c1
Sequence:CCGGCGCAGCTCTTTGGCCTGTAATCTCGAGATTACAGGCCAAAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175935
VALIDATED
G6PC3 MISSION shRNA Lentiviral Transduction Particles
glucose 6 phosphatase, catalytic, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-1360s1c1
Sequence:CCGGCCGCTCACCTTGAACTTCATTCTCGAGAATGAAGTTCAAGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-584s1c1
Sequence:CCGGCGCAGCTCTTTGGCCTGTAATCTCGAGATTACAGGCCAAAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-322s1c1
Sequence:CCGGTGGGCGATCCTAAGAATCTTTCTCGAGAAAGATTCTTAGGATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175935.3-670s1c1
Sequence:CCGGTGGCTTATTGTACCTTCCTATCTCGAGATAGGAAGGTACAATAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175935.3-860s1c1
Sequence:CCGGCCTCATGTATTGGACTCTCTTCTCGAGAAGAGAGTCCAATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-860s21c1
Sequence:CCGGCCTCATGTATTGGACTCTCTTCTCGAGAAGAGAGTCCAATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175935.3-1360s21c1
Sequence:CCGGCCGCTCACCTTGAACTTCATTCTCGAGAATGAAGTTCAAGGTGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-670s21c1
Sequence:CCGGTGGCTTATTGTACCTTCCTATCTCGAGATAGGAAGGTACAATAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-322s21c1
Sequence:CCGGTGGGCGATCCTAAGAATCTTTCTCGAGAAAGATTCTTAGGATCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175935.3-584s21c1
Sequence:CCGGCGCAGCTCTTTGGCCTGTAATCTCGAGATTACAGGCCAAAGAGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138387
VALIDATED
G6PC3 MISSION shRNA Bacterial Glycerol Stock
glucose 6 phosphatase, catalytic, 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-849s1c1
Sequence:CCGGCCTCATCTATTGGACCCTCTTCTCGAGAAGAGGGTCCAATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-421s1c1
Sequence:CCGGCTCATCTTCAAGTGGTTTCTTCTCGAGAAGAAACCACTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-1125s1c1
Sequence:CCGGCCCTCAGATCAGCCTCTTCTACTCGAGTAGAAGAGGCTGATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-288s1c1
Sequence:CCGGCGTGTGGCTCTGGATCACCTTCTCGAGAAGGTGATCCAGAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-658s1c1
Sequence:CCGGCTGGCTTATTGCACCTTCCTTCTCGAGAAGGAAGGTGCAATAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1287s21c1
Sequence:GTACCGGCCCACAAAGCCAACACTCTGTCTCGAGACAGAGTGTTGGCTTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-1125s21c1
Sequence:CCGGCCCTCAGATCAGCCTCTTCTACTCGAGTAGAAGAGGCTGATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-849s21c1
Sequence:CCGGCCTCATCTATTGGACCCTCTTCTCGAGAAGAGGGTCCAATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-421s21c1
Sequence:CCGGCTCATCTTCAAGTGGTTTCTTCTCGAGAAGAAACCACTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-288s21c1
Sequence:CCGGCGTGTGGCTCTGGATCACCTTCTCGAGAAGGTGATCCAGAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1276s21c1
Sequence:GTACCGGTTCCTTTCCCTCCCACAAAGCCTCGAGGCTTTGTGGGAGGGAAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1380s21c1
Sequence:GTACCGGTTCCGCACCACCTGGTCTTAGCTCGAGCTAAGACCAGGTGGTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138387
VALIDATED
G6PC3 MISSION shRNA shRNA Plasmid DNA
glucose 6 phosphatase, catalytic, 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-849s1c1
Sequence:CCGGCCTCATCTATTGGACCCTCTTCTCGAGAAGAGGGTCCAATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-421s1c1
Sequence:CCGGCTCATCTTCAAGTGGTTTCTTCTCGAGAAGAAACCACTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-1125s1c1
Sequence:CCGGCCCTCAGATCAGCCTCTTCTACTCGAGTAGAAGAGGCTGATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-288s1c1
Sequence:CCGGCGTGTGGCTCTGGATCACCTTCTCGAGAAGGTGATCCAGAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-658s1c1
Sequence:CCGGCTGGCTTATTGCACCTTCCTTCTCGAGAAGGAAGGTGCAATAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1287s21c1
Sequence:GTACCGGCCCACAAAGCCAACACTCTGTCTCGAGACAGAGTGTTGGCTTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-1125s21c1
Sequence:CCGGCCCTCAGATCAGCCTCTTCTACTCGAGTAGAAGAGGCTGATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-849s21c1
Sequence:CCGGCCTCATCTATTGGACCCTCTTCTCGAGAAGAGGGTCCAATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-421s21c1
Sequence:CCGGCTCATCTTCAAGTGGTTTCTTCTCGAGAAGAAACCACTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-288s21c1
Sequence:CCGGCGTGTGGCTCTGGATCACCTTCTCGAGAAGGTGATCCAGAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1276s21c1
Sequence:GTACCGGTTCCTTTCCCTCCCACAAAGCCTCGAGGCTTTGTGGGAGGGAAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1380s21c1
Sequence:GTACCGGTTCCGCACCACCTGGTCTTAGCTCGAGCTAAGACCAGGTGGTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138387
VALIDATED
G6PC3 MISSION shRNA Lentiviral Transduction Particles
glucose 6 phosphatase, catalytic, 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-849s1c1
Sequence:CCGGCCTCATCTATTGGACCCTCTTCTCGAGAAGAGGGTCCAATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-421s1c1
Sequence:CCGGCTCATCTTCAAGTGGTTTCTTCTCGAGAAGAAACCACTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-1125s1c1
Sequence:CCGGCCCTCAGATCAGCCTCTTCTACTCGAGTAGAAGAGGCTGATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-288s1c1
Sequence:CCGGCGTGTGGCTCTGGATCACCTTCTCGAGAAGGTGATCCAGAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138387.1-658s1c1
Sequence:CCGGCTGGCTTATTGCACCTTCCTTCTCGAGAAGGAAGGTGCAATAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1287s21c1
Sequence:GTACCGGCCCACAAAGCCAACACTCTGTCTCGAGACAGAGTGTTGGCTTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-1125s21c1
Sequence:CCGGCCCTCAGATCAGCCTCTTCTACTCGAGTAGAAGAGGCTGATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-849s21c1
Sequence:CCGGCCTCATCTATTGGACCCTCTTCTCGAGAAGAGGGTCCAATAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-421s21c1
Sequence:CCGGCTCATCTTCAAGTGGTTTCTTCTCGAGAAGAAACCACTTGAAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_138387.2-288s21c1
Sequence:CCGGCGTGTGGCTCTGGATCACCTTCTCGAGAAGGTGATCCAGAGCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1276s21c1
Sequence:GTACCGGTTCCTTTCCCTCCCACAAAGCCTCGAGGCTTTGTGGGAGGGAAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138387.2-1380s21c1
Sequence:GTACCGGTTCCGCACCACCTGGTCTTAGCTCGAGCTAAGACCAGGTGGTGCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks