EMAIL THIS PAGE TO A FRIEND

G6PC

glucose-6-phosphatase, catalytic subunit

Synonyms: G6PC1 G6PT GSD1 GSD1a
UniProtKB ID: P35575, A1L4C0, B4E1C3, K7EL82
Gene ID:
Human(2538) Summary: Glucose-6-phosphatase (G6Pase) is a multi-subunit integral membrane protein of the endoplasmic reticulum that is composed of a catalytic subunit and transporters for G6P, inorganic phosphate, and glucose. This gene (G6PC) is one of the three glucose-6-phosphatase catalytic-subunit-encoding genes in human: G6PC, G6PC2 and G6PC3. Glucose-6-phosphatase catalyzes the hydrolysis of D-glucose 6-phosphate to D-glucose and orthophosphate and is a key enzyme in glucose homeostasis, functioning in gluconeogenesis and glycogenolysis. Mutations in this gene cause glycogen storage disease type I (GSD1). This disease, also known as von Gierke disease, is a metabolic disorder characterized by severe hypoglycemia associated with the accumulation of glycogen and fat in the liver and kidneys.[provided by RefSeq, Feb 2011]
Mouse(14377) glucose-6-phosphatase, catalytic
Rat(25634) glucose-6-phosphatase, catalytic subunit
domestic cat(723970) glucose-6-phosphatase, catalytic subunit
dog(403492) glucose-6-phosphatase, catalytic subunit
cow(538710) glucose-6-phosphatase, catalytic subunit
domestic guinea pig(100720420) glucose-6-phosphatase, catalytic subunit
naked mole-rat(101708598) glucose-6-phosphatase, catalytic subunit
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108663 Anti-G6PC affinity isolated antibody rat, sheep, human, canine, guinea pig, horse, mouse, rabbit, canine, bovine
immunohistochemistry, western blot pricing
SAB1303137 ANTI-G6PC (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2100870 Anti-G6PC antibody produced in rabbit affinity isolated antibody horse, pig, guinea pig, rat, sheep, bovine, human, mouse, rabbit, rabbit, canine
western blot pricing
HPA052324 Anti-G6PC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106669 Anti-G6PC antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human, horse, rabbit
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3878 Chlorogenic acid ≥95% (titration) rat pricing
25700 Chlorogenic acid hemihydrate ≥98.0% (T) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000151 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000151 Rosetta Predictions human pricing
NM_013098 Rosetta Predictions rat pricing
NM_008061 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024114 predicted 894
2 SASI_Hs01_00024115 predicted 259
3 SASI_Hs01_00024116 predicted 248
4 SASI_Hs02_00301965 predicted 337
5 SASI_Hs01_00024117 predicted 516
6 SASI_Hs01_00024119 predicted 515
7 SASI_Hs01_00024120 predicted 292
8 SASI_Hs01_00024121 predicted 446
9 SASI_Hs01_00024122 predicted 243
10 SASI_Hs01_00024123 predicted 563
11 SASI_Hs01_00024118 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074955 predicted 1005
2 SASI_Rn01_00074956 predicted 1141
3 SASI_Rn01_00074957 predicted 314
4 SASI_Rn02_00260868 predicted 1397
5 SASI_Rn01_00074958 predicted 570
6 SASI_Rn02_00260869 predicted 1117
7 SASI_Rn01_00074959 predicted 1301
8 SASI_Rn01_00074960 predicted 1386
9 SASI_Rn01_00074961 predicted 235
10 SASI_Rn01_00074962 predicted 703
11 SASI_Rn01_00074963 predicted 426
12 SASI_Rn01_00074964 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099475 predicted 465
2 SASI_Mm01_00099476 predicted 809
3 SASI_Mm01_00099477 predicted 574
4 SASI_Mm01_00099478 predicted 317
5 SASI_Mm01_00099479 predicted 1013
6 SASI_Mm01_00099480 predicted 771
7 SASI_Mm01_00099481 predicted 451
8 SASI_Mm01_00099482 predicted 1121
9 SASI_Mm01_00099483 predicted 511
10 SASI_Mm01_00099484 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008061
G6PC MISSION shRNA Bacterial Glycerol Stock
glucose-6-phosphatase, catalytic subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000081388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008061.2-1922s1c1
Sequence:CCGGCCCAGGATTCTTCTCTCCAAACTCGAGTTTGGAGAGAAGAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-1068s1c1
Sequence:CCGGCCTTTGCATCTGTCAGTCTTACTCGAGTAAGACTGACAGATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-523s1c1
Sequence:CCGGCGTCATCTTGTGGTTGGGATTCTCGAGAATCCCAACCACAAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-1015s1c1
Sequence:CCGGCCAGGTTGAGTTGATCTTCTACTCGAGTAGAAGATCAACTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008061
G6PC MISSION shRNA shRNA Plasmid DNA
glucose-6-phosphatase, catalytic subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000081388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008061.2-1922s1c1
Sequence:CCGGCCCAGGATTCTTCTCTCCAAACTCGAGTTTGGAGAGAAGAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-1068s1c1
Sequence:CCGGCCTTTGCATCTGTCAGTCTTACTCGAGTAAGACTGACAGATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-523s1c1
Sequence:CCGGCGTCATCTTGTGGTTGGGATTCTCGAGAATCCCAACCACAAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-1015s1c1
Sequence:CCGGCCAGGTTGAGTTGATCTTCTACTCGAGTAGAAGATCAACTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008061
G6PC MISSION shRNA Lentiviral Transduction Particles
glucose-6-phosphatase, catalytic subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000081388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008061.2-1922s1c1
Sequence:CCGGCCCAGGATTCTTCTCTCCAAACTCGAGTTTGGAGAGAAGAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-1068s1c1
Sequence:CCGGCCTTTGCATCTGTCAGTCTTACTCGAGTAAGACTGACAGATGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-523s1c1
Sequence:CCGGCGTCATCTTGTGGTTGGGATTCTCGAGAATCCCAACCACAAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008061.2-1015s1c1
Sequence:CCGGCCAGGTTGAGTTGATCTTCTACTCGAGTAGAAGATCAACTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000151
G6PC MISSION shRNA Bacterial Glycerol Stock
glucose-6-phosphatase, catalytic subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-642s1c1
Sequence:CCGGGCATTGCTGTTACAGAAACTTCTCGAGAAGTTTCTGTAACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-245s1c1
Sequence:CCGGGCTGTGGGCATTAAACTCCTTCTCGAGAAGGAGTTTAATGCCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-298s1c1
Sequence:CCGGCGTCTTTAAGTGGATTCTCTTCTCGAGAAGAGAATCCACTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-1132s1c1
Sequence:CCGGGCCGCACAAGAAGTCGTTGTACTCGAGTACAACGACTTCTTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000151.2-522s21c1
Sequence:CCGGTTCGGTGCTTGAATGTCATTTCTCGAGAAATGACATTCAAGCACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000151.2-1221s21c1
Sequence:CCGGAGCAATGGGCACTGGTATTTGCTCGAGCAAATACCAGTGCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000151.2-1134s21c1
Sequence:CCGGCGCACAAGAAGTCGTTGTAAGCTCGAGCTTACAACGACTTCTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000151.2-1198s21c1
Sequence:CCGGGATTGAGGAGGACTACTATTTCTCGAGAAATAGTAGTCCTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000151
G6PC MISSION shRNA shRNA Plasmid DNA
glucose-6-phosphatase, catalytic subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-642s1c1
Sequence:CCGGGCATTGCTGTTACAGAAACTTCTCGAGAAGTTTCTGTAACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-245s1c1
Sequence:CCGGGCTGTGGGCATTAAACTCCTTCTCGAGAAGGAGTTTAATGCCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-298s1c1
Sequence:CCGGCGTCTTTAAGTGGATTCTCTTCTCGAGAAGAGAATCCACTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-1132s1c1
Sequence:CCGGGCCGCACAAGAAGTCGTTGTACTCGAGTACAACGACTTCTTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000151.2-522s21c1
Sequence:CCGGTTCGGTGCTTGAATGTCATTTCTCGAGAAATGACATTCAAGCACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000151.2-1221s21c1
Sequence:CCGGAGCAATGGGCACTGGTATTTGCTCGAGCAAATACCAGTGCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000151.2-1134s21c1
Sequence:CCGGCGCACAAGAAGTCGTTGTAAGCTCGAGCTTACAACGACTTCTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000151.2-1198s21c1
Sequence:CCGGGATTGAGGAGGACTACTATTTCTCGAGAAATAGTAGTCCTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000151
G6PC MISSION shRNA Lentiviral Transduction Particles
glucose-6-phosphatase, catalytic subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-642s1c1
Sequence:CCGGGCATTGCTGTTACAGAAACTTCTCGAGAAGTTTCTGTAACAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-245s1c1
Sequence:CCGGGCTGTGGGCATTAAACTCCTTCTCGAGAAGGAGTTTAATGCCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-298s1c1
Sequence:CCGGCGTCTTTAAGTGGATTCTCTTCTCGAGAAGAGAATCCACTTAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000151.1-1132s1c1
Sequence:CCGGGCCGCACAAGAAGTCGTTGTACTCGAGTACAACGACTTCTTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000151.2-522s21c1
Sequence:CCGGTTCGGTGCTTGAATGTCATTTCTCGAGAAATGACATTCAAGCACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000151.2-1221s21c1
Sequence:CCGGAGCAATGGGCACTGGTATTTGCTCGAGCAAATACCAGTGCCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000151.2-1134s21c1
Sequence:CCGGCGCACAAGAAGTCGTTGTAAGCTCGAGCTTACAACGACTTCTTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000151.2-1198s21c1
Sequence:CCGGGATTGAGGAGGACTACTATTTCTCGAGAAATAGTAGTCCTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks