EMAIL THIS PAGE TO A FRIEND

G6PD

glucose-6-phosphate dehydrogenase

72 Gene Product Result for
Synonyms: G6PD1
Gene ID:
Human(2539) Summary: This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(24377) glucose-6-phosphate dehydrogenase
Zebrafish(570579) glucose-6-phosphate dehydrogenase
domestic cat(100270776) glucose-6-phosphate dehydrogenase
cow(281179) glucose-6-phosphate dehydrogenase
Horse(100059734) glucose-6-phosphate dehydrogenase
dog(481088) glucose-6-phosphate dehydrogenase
sheep(443211) glucose-6-phosphate dehydrogenase
Domestic Rabbit(100328765) glucose-6-phosphate dehydrogenase
naked mole-rat(101712640) glucose-6-phosphate dehydrogenase
domestic guinea pig(100722769) glucose-6-phosphate dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108664 Anti-G6PD affinity isolated antibody bovine, rat, human, guinea pig, canine, mouse, sheep, human, rabbit
western blot pricing
SAB2500437 Anti-G6PD (AA 305-318) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, mouse, human
ELISA, western blot pricing
SAB2500438 Anti-G6PD (AA 308-320) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA000247 Anti-G6PD antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100871 Anti-G6PD antibody produced in rabbit affinity isolated antibody human, horse, rabbit, sheep, canine, guinea pig, rabbit, mouse, rat
western blot pricing
HPA000834 Anti-G6PD antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0002539M1 Monoclonal Anti-G6PD antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB5300459 Monoclonal Anti-G6PD antibody produced in mouse clone 5E12, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB5300460 Monoclonal Anti-G6PD antibody produced in mouse clone 2H7, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB1403846 Monoclonal Anti-G6PD, (C-terminal) antibody produced in mouse clone 3H5, ascites fluid human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084001 MISSION® esiRNA esiRNA human G6PD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000402 Rosetta Predictions human pricing
NM_001042351 Rosetta Predictions human pricing
NM_017006 Rosetta Predictions rat pricing
XM_579385 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013421 predicted 718
2 SASI_Hs01_00013422 predicted 1070
3 SASI_Hs02_00302480 predicted 476
4 SASI_Hs01_00013423 predicted 915
5 SASI_Hs01_00013424 predicted 1369
6 SASI_Hs01_00013426 predicted 1447
7 SASI_Hs01_00013427 predicted 766
8 SASI_Hs01_00013429 predicted 1506
9 SASI_Hs01_00013430 predicted 912
10 SASI_Hs02_00302481 predicted 863
11 SASI_Hs01_00013425 predicted 1166
12 SASI_Hs01_00013428 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309188 predicted 588
2 SASI_Hs02_00309189 predicted 950
3 SASI_Hs02_00309190 predicted 354
4 SASI_Hs02_00309191 predicted 784
5 SASI_Hs02_00309192 predicted 1237
6 SASI_Hs02_00309193 predicted 1321
7 SASI_Hs02_00309194 predicted 640
8 SASI_Hs02_00309195 predicted 1379
9 SASI_Hs02_00309196 predicted 788
10 SASI_Hs02_00309197 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261158 predicted 1461
2 SASI_Rn01_00070789 predicted 401
3 SASI_Rn02_00261159 predicted 954
4 SASI_Rn02_00261160 predicted 1557
5 SASI_Rn02_00261161 predicted 195
6 SASI_Rn02_00261162 predicted 502
7 SASI_Rn02_00261163 predicted 196
8 SASI_Rn01_00070787 predicted 724
9 SASI_Rn01_00070788 predicted 900
10 SASI_Rn01_00070790 predicted 354
11 SASI_Rn01_00070791 predicted 1172
12 SASI_Rn01_00070792 predicted 1308
13 SASI_Rn01_00070793 predicted 867
14 SASI_Rn01_00070794 predicted 577
15 SASI_Rn01_00070795 predicted 1667
16 SASI_Rn01_00070796 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164250 predicted 564
2 SASI_Rn01_00164251 predicted 732
3 SASI_Rn01_00164252 predicted 574
4 SASI_Rn01_00164253 predicted 1017
5 SASI_Rn01_00164254 predicted 1143
6 SASI_Rn01_00164255 predicted 713
7 SASI_Rn01_00164256 predicted 721
8 SASI_Rn01_00164257 predicted 422
9 SASI_Rn01_00164258 predicted 1510
10 SASI_Rn01_00164259 predicted 1519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000402
VALIDATED
G6PD MISSION shRNA Bacterial Glycerol Stock
glucose-6-phosphate dehydrogenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1513s21c1
Sequence:CCGGCAACAGATACAAGAACGTGAACTCGAGTTCACGTTCTTGTATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1256s21c1
Sequence:CCGGGTCGTCCTCTATGTGGAGAATCTCGAGATTCTCCACATAGAGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1720s21c1
Sequence:CCGGGCTGATGAAGAGAGTGGGTTTCTCGAGAAACCCACTCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-319s21c1
Sequence:CCGGTCAGTCGGATACACACATATTCTCGAGAATATGTGTGTATCCGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1491s1c1
Sequence:CCGGGTCGTCCTCTATGTGGAGAATCTCGAGATTCTCCACATAGAGGACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1748s1c1
Sequence:CCGGCAACAGATACAAGAACGTGAACTCGAGTTCACGTTCTTGTATCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-554s1c1
Sequence:CCGGTCAGTCGGATACACACATATTCTCGAGAATATGTGTGTATCCGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1914s1c1
Sequence:CCGGCCCTATATTTATGGCAGCCGACTCGAGTCGGCTGCCATAAATATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000402
VALIDATED
G6PD MISSION shRNA shRNA Plasmid DNA
glucose-6-phosphate dehydrogenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1513s21c1
Sequence:CCGGCAACAGATACAAGAACGTGAACTCGAGTTCACGTTCTTGTATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1256s21c1
Sequence:CCGGGTCGTCCTCTATGTGGAGAATCTCGAGATTCTCCACATAGAGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1720s21c1
Sequence:CCGGGCTGATGAAGAGAGTGGGTTTCTCGAGAAACCCACTCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-319s21c1
Sequence:CCGGTCAGTCGGATACACACATATTCTCGAGAATATGTGTGTATCCGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1491s1c1
Sequence:CCGGGTCGTCCTCTATGTGGAGAATCTCGAGATTCTCCACATAGAGGACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1748s1c1
Sequence:CCGGCAACAGATACAAGAACGTGAACTCGAGTTCACGTTCTTGTATCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-554s1c1
Sequence:CCGGTCAGTCGGATACACACATATTCTCGAGAATATGTGTGTATCCGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1914s1c1
Sequence:CCGGCCCTATATTTATGGCAGCCGACTCGAGTCGGCTGCCATAAATATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000402
VALIDATED
G6PD MISSION shRNA Lentiviral Transduction Particles
glucose-6-phosphate dehydrogenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1513s21c1
Sequence:CCGGCAACAGATACAAGAACGTGAACTCGAGTTCACGTTCTTGTATCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1256s21c1
Sequence:CCGGGTCGTCCTCTATGTGGAGAATCTCGAGATTCTCCACATAGAGGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-1720s21c1
Sequence:CCGGGCTGATGAAGAGAGTGGGTTTCTCGAGAAACCCACTCTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000402.3-319s21c1
Sequence:CCGGTCAGTCGGATACACACATATTCTCGAGAATATGTGTGTATCCGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1491s1c1
Sequence:CCGGGTCGTCCTCTATGTGGAGAATCTCGAGATTCTCCACATAGAGGACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1748s1c1
Sequence:CCGGCAACAGATACAAGAACGTGAACTCGAGTTCACGTTCTTGTATCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-554s1c1
Sequence:CCGGTCAGTCGGATACACACATATTCTCGAGAATATGTGTGTATCCGACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_000402.2-1914s1c1
Sequence:CCGGCCCTATATTTATGGCAGCCGACTCGAGTCGGCTGCCATAAATATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks