EMAIL THIS PAGE TO A FRIEND

GAA

glucosidase, alpha; acid

80 Gene Product Result for
Synonyms: LYAG
UniProtKB ID: P10253, Q09GN4, Q14351, Q16302, Q8IWE7
Gene ID:
Human(2548) Summary: This gene encodes acid alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. Different forms of acid alpha-glucosidase are obtained by proteolytic processing. Defects in this gene are the cause of glycogen storage disease II, also known as Pompe's disease, which is an autosomal recessive disorder with a broad clinical spectrum. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14387) glucosidase, alpha, acid
Rat(367562) glucosidase, alpha, acid
Zebrafish(100002366) glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II)
domestic cat(101086359) glucosidase, alpha; acid
cow(280798) glucosidase, alpha; acid
Horse(100056675) glucosidase, alpha; acid
dog(483352) glucosidase, alpha; acid
chicken(416462) glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II)
sheep(101121692) glucosidase, alpha; acid
domestic guinea pig(100728030) glucosidase, alpha; acid
naked mole-rat(101718861) glucosidase, alpha; acid
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK123 α-Glucosidase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000152 Rosetta Predictions human pricing
NM_001079803 Rosetta Predictions human pricing
NM_001079804 Rosetta Predictions human pricing
NM_199118 Rosetta Predictions rat pricing
NM_008064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246397 predicted 2245
2 SASI_Hs01_00246398 predicted 981
3 SASI_Hs01_00246399 predicted 3006
4 SASI_Hs01_00246401 predicted 881
5 SASI_Hs01_00246402 predicted 2247
6 SASI_Hs01_00246403 predicted 1667
7 SASI_Hs01_00246404 predicted 902
8 SASI_Hs01_00246405 predicted 1075
9 SASI_Hs02_00301966 predicted 3196
10 SASI_Hs02_00301967 predicted 686
11 SASI_Hs01_00246400 predicted 849
12 SASI_Hs01_00246406 predicted 3313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313720 predicted 2065
2 SASI_Hs02_00313721 predicted 801
3 SASI_Hs02_00313722 predicted 2823
4 SASI_Hs02_00313723 predicted 702
5 SASI_Hs02_00313724 predicted 2061
6 SASI_Hs02_00313725 predicted 1484
7 SASI_Hs02_00313726 predicted 717
8 SASI_Hs02_00313727 predicted 893
9 SASI_Hs02_00313728 predicted 3017
10 SASI_Hs02_00313729 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313730 predicted 1983
2 SASI_Hs02_00313731 predicted 720
3 SASI_Hs02_00313732 predicted 2736
4 SASI_Hs02_00313733 predicted 621
5 SASI_Hs02_00313734 predicted 1985
6 SASI_Hs02_00313735 predicted 1404
7 SASI_Hs02_00313736 predicted 642
8 SASI_Hs02_00313737 predicted 814
9 SASI_Hs02_00313738 predicted 2937
10 SASI_Hs02_00313739 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046874 predicted 784
2 SASI_Rn01_00046875 predicted 568
3 SASI_Rn01_00046876 predicted 1435
4 SASI_Rn01_00046877 predicted 1166
5 SASI_Rn01_00046878 predicted 2054
6 SASI_Rn01_00046879 predicted 966
7 SASI_Rn01_00046880 predicted 1048
8 SASI_Rn02_00270143 predicted 1884
9 SASI_Rn02_00270144 predicted 2556
10 SASI_Rn01_00046881 predicted 1587
11 SASI_Rn01_00046882 predicted 1378
12 SASI_Rn01_00046883 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169540 predicted 2100
2 SASI_Mm01_00169541 predicted 765
3 SASI_Mm01_00169542 predicted 297
4 SASI_Mm01_00169543 predicted 617
5 SASI_Mm01_00169544 predicted 1685
6 SASI_Mm01_00169545 predicted 1903
7 SASI_Mm01_00169546 predicted 1143
8 SASI_Mm01_00169547 predicted 930
9 SASI_Mm01_00169548 predicted 2165
10 SASI_Mm01_00169549 predicted 1616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008064
VALIDATED
GAA MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; acid
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-2867s1c1
Sequence:CCGGCAAGAACAATACCATTGTGAACTCGAGTTCACAATGGTATTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1454s1c1
Sequence:CCGGCCGAAGAGACTTCACCTTCAACTCGAGTTGAAGGTGAAGTCTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1265s1c1
Sequence:CCGGCAAGAGCGTTGTGCAACAATACTCGAGTATTGTTGCACAACGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008064.2-3224s1c1
Sequence:CCGGCCCTGAAGCTCTGTGTTCTTACTCGAGTAAGAACACAGAGCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1264s1c1
Sequence:CCGGCCAAGAGCGTTGTGCAACAATCTCGAGATTGTTGCACAACGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-756s1c1
Sequence:CCGGCGCCTCCACTTCAAGATCAAACTCGAGTTTGATCTTGAAGTGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-310s21c1
Sequence:CCGGATCTCATGCTTCGGGAGTTAACTCGAGTTAACTCCCGAAGCATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-1454s21c1
Sequence:CCGGCCGAAGAGACTTCACCTTCAACTCGAGTTGAAGGTGAAGTCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-1265s21c1
Sequence:CCGGCAAGAGCGTTGTGCAACAATACTCGAGTATTGTTGCACAACGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-756s21c1
Sequence:CCGGCGCCTCCACTTCAAGATCAAACTCGAGTTTGATCTTGAAGTGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-3174s21c1
Sequence:CCGGTGCTCTCCTGACACATCTTTGCTCGAGCAAAGATGTGTCAGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008064
VALIDATED
GAA MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; acid
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-2867s1c1
Sequence:CCGGCAAGAACAATACCATTGTGAACTCGAGTTCACAATGGTATTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1454s1c1
Sequence:CCGGCCGAAGAGACTTCACCTTCAACTCGAGTTGAAGGTGAAGTCTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1265s1c1
Sequence:CCGGCAAGAGCGTTGTGCAACAATACTCGAGTATTGTTGCACAACGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008064.2-3224s1c1
Sequence:CCGGCCCTGAAGCTCTGTGTTCTTACTCGAGTAAGAACACAGAGCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1264s1c1
Sequence:CCGGCCAAGAGCGTTGTGCAACAATCTCGAGATTGTTGCACAACGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-756s1c1
Sequence:CCGGCGCCTCCACTTCAAGATCAAACTCGAGTTTGATCTTGAAGTGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-310s21c1
Sequence:CCGGATCTCATGCTTCGGGAGTTAACTCGAGTTAACTCCCGAAGCATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-1454s21c1
Sequence:CCGGCCGAAGAGACTTCACCTTCAACTCGAGTTGAAGGTGAAGTCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-1265s21c1
Sequence:CCGGCAAGAGCGTTGTGCAACAATACTCGAGTATTGTTGCACAACGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-756s21c1
Sequence:CCGGCGCCTCCACTTCAAGATCAAACTCGAGTTTGATCTTGAAGTGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-3174s21c1
Sequence:CCGGTGCTCTCCTGACACATCTTTGCTCGAGCAAAGATGTGTCAGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008064
VALIDATED
GAA MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; acid
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-2867s1c1
Sequence:CCGGCAAGAACAATACCATTGTGAACTCGAGTTCACAATGGTATTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1454s1c1
Sequence:CCGGCCGAAGAGACTTCACCTTCAACTCGAGTTGAAGGTGAAGTCTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1265s1c1
Sequence:CCGGCAAGAGCGTTGTGCAACAATACTCGAGTATTGTTGCACAACGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189608    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008064.2-3224s1c1
Sequence:CCGGCCCTGAAGCTCTGTGTTCTTACTCGAGTAAGAACACAGAGCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-1264s1c1
Sequence:CCGGCCAAGAGCGTTGTGCAACAATCTCGAGATTGTTGCACAACGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008064.2-756s1c1
Sequence:CCGGCGCCTCCACTTCAAGATCAAACTCGAGTTTGATCTTGAAGTGGAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-310s21c1
Sequence:CCGGATCTCATGCTTCGGGAGTTAACTCGAGTTAACTCCCGAAGCATGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-1454s21c1
Sequence:CCGGCCGAAGAGACTTCACCTTCAACTCGAGTTGAAGGTGAAGTCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-1265s21c1
Sequence:CCGGCAAGAGCGTTGTGCAACAATACTCGAGTATTGTTGCACAACGCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-756s21c1
Sequence:CCGGCGCCTCCACTTCAAGATCAAACTCGAGTTTGATCTTGAAGTGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008064.2-3174s21c1
Sequence:CCGGTGCTCTCCTGACACATCTTTGCTCGAGCAAAGATGTGTCAGGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000152
VALIDATED
GAA MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; acid
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-1750s1c1
Sequence:CCGGCGCTACATGATGATCGTGGATCTCGAGATCCACGATCATCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-973s1c1
Sequence:CCGGCGCCTCCACTTCACGATCAAACTCGAGTTTGATCGTGAAGTGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-3081s1c1
Sequence:CCGGCAGGAATAACACGATCGTGAACTCGAGTTCACGATCGTGTTATTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-1674s1c1
Sequence:CCGGGAGGGACTTCACGTTCAACAACTCGAGTTGTTGAACGTGAAGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000152.2-2127s1c1
Sequence:CCGGCCAGTTTCTCTCCACACACTACTCGAGTAGTGTGTGGAGAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-784s21c1
Sequence:CCGGGAACCTGAGCTCCTCTGAAATCTCGAGATTTCAGAGGAGCTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-1676s21c1
Sequence:CCGGCGCTACATGATGATCGTGGATCTCGAGATCCACGATCATCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000152.3-1600s21c1
Sequence:CCGGGAGGGACTTCACGTTCAACAACTCGAGTTGTTGAACGTGAAGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-3189s21c1
Sequence:CCGGTGTTGATGGGAGAGCAGTTTCCTCGAGGAAACTGCTCTCCCATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000152
VALIDATED
GAA MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; acid
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-1750s1c1
Sequence:CCGGCGCTACATGATGATCGTGGATCTCGAGATCCACGATCATCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-973s1c1
Sequence:CCGGCGCCTCCACTTCACGATCAAACTCGAGTTTGATCGTGAAGTGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-3081s1c1
Sequence:CCGGCAGGAATAACACGATCGTGAACTCGAGTTCACGATCGTGTTATTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-1674s1c1
Sequence:CCGGGAGGGACTTCACGTTCAACAACTCGAGTTGTTGAACGTGAAGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000152.2-2127s1c1
Sequence:CCGGCCAGTTTCTCTCCACACACTACTCGAGTAGTGTGTGGAGAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-784s21c1
Sequence:CCGGGAACCTGAGCTCCTCTGAAATCTCGAGATTTCAGAGGAGCTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-1676s21c1
Sequence:CCGGCGCTACATGATGATCGTGGATCTCGAGATCCACGATCATCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000152.3-1600s21c1
Sequence:CCGGGAGGGACTTCACGTTCAACAACTCGAGTTGTTGAACGTGAAGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-3189s21c1
Sequence:CCGGTGTTGATGGGAGAGCAGTTTCCTCGAGGAAACTGCTCTCCCATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000152
VALIDATED
GAA MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; acid
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-1750s1c1
Sequence:CCGGCGCTACATGATGATCGTGGATCTCGAGATCCACGATCATCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-973s1c1
Sequence:CCGGCGCCTCCACTTCACGATCAAACTCGAGTTTGATCGTGAAGTGGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-3081s1c1
Sequence:CCGGCAGGAATAACACGATCGTGAACTCGAGTTCACGATCGTGTTATTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000152.2-1674s1c1
Sequence:CCGGGAGGGACTTCACGTTCAACAACTCGAGTTGTTGAACGTGAAGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000152.2-2127s1c1
Sequence:CCGGCCAGTTTCTCTCCACACACTACTCGAGTAGTGTGTGGAGAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-784s21c1
Sequence:CCGGGAACCTGAGCTCCTCTGAAATCTCGAGATTTCAGAGGAGCTCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-1676s21c1
Sequence:CCGGCGCTACATGATGATCGTGGATCTCGAGATCCACGATCATCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000152.3-1600s21c1
Sequence:CCGGGAGGGACTTCACGTTCAACAACTCGAGTTGTTGAACGTGAAGTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000152.3-3189s21c1
Sequence:CCGGTGTTGATGGGAGAGCAGTTTCCTCGAGGAAACTGCTCTCCCATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks