EMAIL THIS PAGE TO A FRIEND

GAB1

GRB2-associated binding protein 1

77 Gene Product Result for
UniProtKB ID: Q13480, A8K152, Q4W5G2, Q6P1W2
Gene ID:
Human(2549) Summary: The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(14388) growth factor receptor bound protein 2-associated protein 1
Rat(361388) GRB2-associated binding protein 1
Zebrafish(406666) GRB2-associated binding protein 1
cow(540085) GRB2-associated binding protein 1
Horse(100062924) GRB2-associated binding protein 1
domestic cat(101088326) GRB2-associated binding protein 1
dog(483808) GRB2-associated binding protein 1
chicken(422456) GRB2-associated binding protein 1
naked mole-rat(101721604) GRB2-associated binding protein 1
domestic guinea pig(100730023) GRB2-associated binding protein 1
sheep(101112165) GRB2-associated binding protein 1
Domestic Rabbit(100346125) GRB2-associated binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G1298 Anti-GAB1 (222-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300534 Anti-GAB1 (Ab-627) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB1405837 Anti-GAB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV09028 Anti-GAB1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, rat, human, mouse
western blot pricing
HPA049599 Anti-GAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4501060 Anti-GAB1, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4501061 Anti-GAB1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4300231 Anti-phospho-GAB1 (pTyr627) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
SAB4504412 Anti-phospho-GAB1 (pTyr627) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4504091 Anti-phospho-GAB1 (pTyr659) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
WH0002549M1 Monoclonal Anti-GAB1 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
SAB5300293 Monoclonal Anti-GAB1 antibody produced in mouse clone 1A7, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002039 Rosetta Predictions human pricing
NM_207123 Rosetta Predictions human pricing
NM_001108444 Rosetta Predictions rat pricing
NM_021356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148755 predicted 1008
2 SASI_Hs01_00148756 predicted 2387
3 SASI_Hs02_00333068 predicted 2385
4 SASI_Hs01_00148757 predicted 1106
5 SASI_Hs02_00333069 predicted 1120
6 SASI_Hs01_00148759 predicted 2021
7 SASI_Hs01_00148760 predicted 2031
8 SASI_Hs01_00148761 predicted 1569
9 SASI_Hs02_00333070 predicted 428
10 SASI_Hs01_00148763 predicted 373
11 SASI_Hs01_00148758 predicted 849
12 SASI_Hs01_00148762 predicted 2221
13 SASI_Hs01_00148764 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171280 predicted 1002
2 SASI_Hs01_00171281 predicted 2478
3 SASI_Hs02_00373778 predicted 2471
4 SASI_Hs01_00171282 predicted 1113
5 SASI_Hs02_00373779 predicted 1128
6 SASI_Hs01_00171284 predicted 2105
7 SASI_Hs01_00171285 predicted 2119
8 SASI_Hs01_00171286 predicted 1576
9 SASI_Hs02_00373780 predicted 422
10 SASI_Hs01_00171288 predicted 375
11 SASI_Hs01_00171283 predicted 855
12 SASI_Hs01_00171287 predicted 2305
13 SASI_Hs01_00171289 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238699 predicted 450
2 SASI_Rn02_00238700 predicted 1239
3 SASI_Rn02_00238701 predicted 1177
4 SASI_Rn02_00238702 predicted 1156
5 SASI_Rn02_00238703 predicted 2462
6 SASI_Rn02_00238704 predicted 2056
7 SASI_Rn02_00238705 predicted 325
8 SASI_Rn02_00238706 predicted 829
9 SASI_Rn02_00238707 predicted 1271
10 SASI_Rn02_00238708 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052214 predicted 1775
2 SASI_Mm01_00052217 predicted 1275
3 SASI_Mm01_00052218 predicted 2071
4 SASI_Mm02_00325945 predicted 1215
5 SASI_Mm01_00052219 predicted 1037
6 SASI_Mm01_00052220 predicted 921
7 SASI_Mm01_00052222 predicted 1453
8 SASI_Mm02_00325946 predicted 1778
9 SASI_Mm02_00325947 predicted 3012
10 SASI_Mm02_00325948 predicted 1923
11 SASI_Mm01_00052215 predicted 1204
12 SASI_Mm01_00052216 predicted 1051
13 SASI_Mm01_00052221 predicted 3014
14 SASI_Mm01_00052223 predicted 2529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002039
GAB1 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002039.3-455s21c1
Sequence:CCCGGTTACGCAGTGGCCGTTTAACCTCGAGGTTAAACGGCCACTGCGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002039.3-2759s21c1
Sequence:CCGGCCAATGTACCTTACCATAATTCTCGAGAATTATGGTAAGGTACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002039.3-2692s21c1
Sequence:CCGGAGTTAACACACTCGTAGTATTCTCGAGAATACTACGAGTGTGTTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002039.3-1136s21c1
Sequence:CCGGTAACCTGCCCAGGAGTTATTCCTCGAGGAATAACTCCTGGGCAGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1437s1c1
Sequence:CCGGGCTATGATATTCCACGAGCATCTCGAGATGCTCGTGGAATATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1366s1c1
Sequence:CCGGGCCTTCACGTAGTAATACCATCTCGAGATGGTATTACTACGTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1160s1c1
Sequence:CCGGCCTGGTAATACTTATCAGATTCTCGAGAATCTGATAAGTATTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-431s1c1
Sequence:CCGGGCTGGATTGACATTTAACAAACTCGAGTTTGTTAAATGTCAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002039.2-2988s1c1
Sequence:CCGGGCACCTTTGAAAGACTGAATACTCGAGTATTCAGTCTTTCAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002039
GAB1 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002039.3-455s21c1
Sequence:CCCGGTTACGCAGTGGCCGTTTAACCTCGAGGTTAAACGGCCACTGCGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002039.3-2759s21c1
Sequence:CCGGCCAATGTACCTTACCATAATTCTCGAGAATTATGGTAAGGTACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002039.3-2692s21c1
Sequence:CCGGAGTTAACACACTCGTAGTATTCTCGAGAATACTACGAGTGTGTTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002039.3-1136s21c1
Sequence:CCGGTAACCTGCCCAGGAGTTATTCCTCGAGGAATAACTCCTGGGCAGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1437s1c1
Sequence:CCGGGCTATGATATTCCACGAGCATCTCGAGATGCTCGTGGAATATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1366s1c1
Sequence:CCGGGCCTTCACGTAGTAATACCATCTCGAGATGGTATTACTACGTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1160s1c1
Sequence:CCGGCCTGGTAATACTTATCAGATTCTCGAGAATCTGATAAGTATTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-431s1c1
Sequence:CCGGGCTGGATTGACATTTAACAAACTCGAGTTTGTTAAATGTCAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002039.2-2988s1c1
Sequence:CCGGGCACCTTTGAAAGACTGAATACTCGAGTATTCAGTCTTTCAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002039
GAB1 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002039.3-455s21c1
Sequence:CCCGGTTACGCAGTGGCCGTTTAACCTCGAGGTTAAACGGCCACTGCGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002039.3-2759s21c1
Sequence:CCGGCCAATGTACCTTACCATAATTCTCGAGAATTATGGTAAGGTACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002039.3-2692s21c1
Sequence:CCGGAGTTAACACACTCGTAGTATTCTCGAGAATACTACGAGTGTGTTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002039.3-1136s21c1
Sequence:CCGGTAACCTGCCCAGGAGTTATTCCTCGAGGAATAACTCCTGGGCAGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1437s1c1
Sequence:CCGGGCTATGATATTCCACGAGCATCTCGAGATGCTCGTGGAATATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1366s1c1
Sequence:CCGGGCCTTCACGTAGTAATACCATCTCGAGATGGTATTACTACGTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-1160s1c1
Sequence:CCGGCCTGGTAATACTTATCAGATTCTCGAGAATCTGATAAGTATTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002039.2-431s1c1
Sequence:CCGGGCTGGATTGACATTTAACAAACTCGAGTTTGTTAAATGTCAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002039.2-2988s1c1
Sequence:CCGGGCACCTTTGAAAGACTGAATACTCGAGTATTCAGTCTTTCAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021356
VALIDATED
GAB1 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-1281s21c1
Sequence:CCGGCGTCGATTCACCTTTCGCTATCTCGAGATAGCGAAAGGTGAATCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021356.2-3713s21c1
Sequence:CCGGGCCTGCTCTTACTCCTGTTTACTCGAGTAAACAGGAGTAAGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-1554s21c1
Sequence:CCGGCCAGAGCAAACACGGAATGAACTCGAGTTCATTCCGTGTTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-2749s21c1
Sequence:CCGGCAAGTCGAATACCTGGATTTACTCGAGTAAATCCAGGTATTCGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-3713s1c1
Sequence:CCGGGCCTGCTCTTACTCCTGTTTACTCGAGTAAACAGGAGTAAGAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-1554s1c1
Sequence:CCGGCCAGAGCAAACACGGAATGAACTCGAGTTCATTCCGTGTTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-1281s1c1
Sequence:CCGGCGTCGATTCACCTTTCGCTATCTCGAGATAGCGAAAGGTGAATCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-2077s1c1
Sequence:CCGGGCTAGTTCTCAAGATTGCTATCTCGAGATAGCAATCTTGAGAACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021356.2-2749s1c1
Sequence:CCGGCAAGTCGAATACCTGGATTTACTCGAGTAAATCCAGGTATTCGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021356
VALIDATED
GAB1 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-1281s21c1
Sequence:CCGGCGTCGATTCACCTTTCGCTATCTCGAGATAGCGAAAGGTGAATCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021356.2-3713s21c1
Sequence:CCGGGCCTGCTCTTACTCCTGTTTACTCGAGTAAACAGGAGTAAGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-1554s21c1
Sequence:CCGGCCAGAGCAAACACGGAATGAACTCGAGTTCATTCCGTGTTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-2749s21c1
Sequence:CCGGCAAGTCGAATACCTGGATTTACTCGAGTAAATCCAGGTATTCGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-3713s1c1
Sequence:CCGGGCCTGCTCTTACTCCTGTTTACTCGAGTAAACAGGAGTAAGAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-1554s1c1
Sequence:CCGGCCAGAGCAAACACGGAATGAACTCGAGTTCATTCCGTGTTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-1281s1c1
Sequence:CCGGCGTCGATTCACCTTTCGCTATCTCGAGATAGCGAAAGGTGAATCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-2077s1c1
Sequence:CCGGGCTAGTTCTCAAGATTGCTATCTCGAGATAGCAATCTTGAGAACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021356.2-2749s1c1
Sequence:CCGGCAAGTCGAATACCTGGATTTACTCGAGTAAATCCAGGTATTCGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021356
VALIDATED
GAB1 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-1281s21c1
Sequence:CCGGCGTCGATTCACCTTTCGCTATCTCGAGATAGCGAAAGGTGAATCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021356.2-3713s21c1
Sequence:CCGGGCCTGCTCTTACTCCTGTTTACTCGAGTAAACAGGAGTAAGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-1554s21c1
Sequence:CCGGCCAGAGCAAACACGGAATGAACTCGAGTTCATTCCGTGTTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021356.2-2749s21c1
Sequence:CCGGCAAGTCGAATACCTGGATTTACTCGAGTAAATCCAGGTATTCGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-3713s1c1
Sequence:CCGGGCCTGCTCTTACTCCTGTTTACTCGAGTAAACAGGAGTAAGAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-1554s1c1
Sequence:CCGGCCAGAGCAAACACGGAATGAACTCGAGTTCATTCCGTGTTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-1281s1c1
Sequence:CCGGCGTCGATTCACCTTTCGCTATCTCGAGATAGCGAAAGGTGAATCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021356.2-2077s1c1
Sequence:CCGGGCTAGTTCTCAAGATTGCTATCTCGAGATAGCAATCTTGAGAACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021356.2-2749s1c1
Sequence:CCGGCAAGTCGAATACCTGGATTTACTCGAGTAAATCCAGGTATTCGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)