EMAIL THIS PAGE TO A FRIEND

GAB2

GRB2-associated binding protein 2

133 Gene Product Result for
UniProtKB ID: Q9UQC2, A2RRM2, A6NEW9, A7MD36, O60317
Gene ID:
Human(9846) Summary: This gene is a member of the GRB2-associated binding protein (GAB) gene family. These proteins contain pleckstrin homology (PH) domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. They act as adapters for transmitting various signals in response to stimuli through cytokine and growth factor receptors, and T- and B-cell antigen receptors. The protein encoded by this gene is the principal activator of phosphatidylinositol-3 kinase in response to activation of the high affinity IgE receptor. Two alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
Mouse(14389) growth factor receptor bound protein 2-associated protein 2
Rat(84477) GRB2-associated binding protein 2
sheep(101115743) GRB2-associated binding protein 2
Domestic Rabbit(100349301) GRB2-associated binding protein 2
domestic guinea pig(100732375) GRB2-associated binding protein 2
naked mole-rat(101719954) GRB2-associated binding protein 2
Zebrafish(564517) GRB2-associated binding protein 2
cow(529346) GRB2-associated binding protein 2
Horse(100062877) GRB2-associated binding protein 2
domestic cat(101101410) GRB2-associated binding protein 2
dog(485167) GRB2-associated binding protein 2
chicken(419027) GRB2-associated binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500439 Anti-GAB2 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, rat, mouse
ELISA, western blot pricing
HPA000271 Anti-GAB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1408655 Anti-GAB2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4503712 Anti-GAB2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
HPA001368 Anti-GAB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503713 Anti-GAB2, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503714 Anti-GAB2, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4504706 Anti-phospho-Gab2 (pSer623) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301361 Anti-phospho-Gab2 (pSer623) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4504705 Anti-phospho-Gab2 (pTyr643) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301360 Anti-phospho-Gab2 (pTyr643) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4504672 Anti-phospho-GRB2 (pSer159) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301330 Anti-phospho-GRB2 (pSer159) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078741 MISSION® esiRNA esiRNA human GAB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012296 Rosetta Predictions human pricing
NM_080491 Rosetta Predictions human pricing
NM_053417 Rosetta Predictions rat pricing
NM_010248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075054 predicted 2544
2 SASI_Hs01_00075055 predicted 1584
3 SASI_Hs01_00075056 predicted 1451
4 SASI_Hs01_00075057 predicted 2455
5 SASI_Hs01_00075058 predicted 1634
6 SASI_Hs01_00075059 predicted 2535
7 SASI_Hs01_00075060 predicted 1431
8 SASI_Hs01_00075061 predicted 619
9 SASI_Hs01_00075062 predicted 1373
10 SASI_Hs01_00075063 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160948 predicted 2500
2 SASI_Hs01_00160949 predicted 1540
3 SASI_Hs01_00160950 predicted 1399
4 SASI_Hs01_00160951 predicted 2410
5 SASI_Hs01_00160952 predicted 1585
6 SASI_Hs01_00160953 predicted 2491
7 SASI_Hs01_00160954 predicted 1391
8 SASI_Hs01_00160955 predicted 577
9 SASI_Hs01_00160956 predicted 1327
10 SASI_Hs01_00160957 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088568 predicted 1156
2 SASI_Rn01_00088569 predicted 244
3 SASI_Rn01_00088570 predicted 1610
4 SASI_Rn01_00088571 predicted 655
5 SASI_Rn01_00088572 predicted 862
6 SASI_Rn01_00088573 predicted 219
7 SASI_Rn01_00088574 predicted 1127
8 SASI_Rn01_00088575 predicted 695
9 SASI_Rn01_00088576 predicted 990
10 SASI_Rn01_00088577 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054338 predicted 1781
2 SASI_Mm01_00054339 predicted 209
3 SASI_Mm01_00054340 predicted 1222
4 SASI_Mm01_00054341 predicted 1684
5 SASI_Mm01_00054342 predicted 825
6 SASI_Mm01_00054343 predicted 1200
7 SASI_Mm01_00054344 predicted 1837
8 SASI_Mm02_00318137 predicted 459
9 SASI_Mm01_00054346 predicted 555
10 SASI_Mm01_00054347 predicted 848
11 SASI_Mm01_00054345 predicted 1372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012296
VALIDATED
GAB2 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012296.2-542s1c1
Sequence:CCGGCAGCCAACTCTGTTCACGTTTCTCGAGAAACGTGAACAGAGTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012296.2-1785s1c1
Sequence:CCGGGCGAAGAGAACTATGTCCCTACTCGAGTAGGGACATAGTTCTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012296.2-4494s1c1
Sequence:CCGGGCCCTGAATGTGTGCCTTAAACTCGAGTTTAAGGCACACATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012296.2-5107s1c1
Sequence:CCGGGCTCCACTTCTGCAAGGTTAACTCGAGTTAACCTTGCAGAAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-1602s21c1
Sequence:CCGGCTGATCGGAAAGCAAAGCCAACTCGAGTTGGCTTTGCTTTCCGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-623s21c1
Sequence:CCGGCTCTACTTGCACCAGTGCATACTCGAGTATGCACTGGTGCAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-1493s21c1
Sequence:CCGGGCCCATCACTTTGACTCACTTCTCGAGAAGTGAGTCAAAGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012296
VALIDATED
GAB2 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012296.2-542s1c1
Sequence:CCGGCAGCCAACTCTGTTCACGTTTCTCGAGAAACGTGAACAGAGTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012296.2-1785s1c1
Sequence:CCGGGCGAAGAGAACTATGTCCCTACTCGAGTAGGGACATAGTTCTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012296.2-4494s1c1
Sequence:CCGGGCCCTGAATGTGTGCCTTAAACTCGAGTTTAAGGCACACATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012296.2-5107s1c1
Sequence:CCGGGCTCCACTTCTGCAAGGTTAACTCGAGTTAACCTTGCAGAAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-1602s21c1
Sequence:CCGGCTGATCGGAAAGCAAAGCCAACTCGAGTTGGCTTTGCTTTCCGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-623s21c1
Sequence:CCGGCTCTACTTGCACCAGTGCATACTCGAGTATGCACTGGTGCAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-1493s21c1
Sequence:CCGGGCCCATCACTTTGACTCACTTCTCGAGAAGTGAGTCAAAGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012296
VALIDATED
GAB2 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012296.2-542s1c1
Sequence:CCGGCAGCCAACTCTGTTCACGTTTCTCGAGAAACGTGAACAGAGTTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012296.2-1785s1c1
Sequence:CCGGGCGAAGAGAACTATGTCCCTACTCGAGTAGGGACATAGTTCTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012296.2-4494s1c1
Sequence:CCGGGCCCTGAATGTGTGCCTTAAACTCGAGTTTAAGGCACACATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012296.2-5107s1c1
Sequence:CCGGGCTCCACTTCTGCAAGGTTAACTCGAGTTAACCTTGCAGAAGTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-1602s21c1
Sequence:CCGGCTGATCGGAAAGCAAAGCCAACTCGAGTTGGCTTTGCTTTCCGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-623s21c1
Sequence:CCGGCTCTACTTGCACCAGTGCATACTCGAGTATGCACTGGTGCAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012296.3-1493s21c1
Sequence:CCGGGCCCATCACTTTGACTCACTTCTCGAGAAGTGAGTCAAAGTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010248
GAB2 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-573s1c1
Sequence:CCGGCCAGCCTACTTTATTCACGTTCTCGAGAACGTGAATAAAGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-1629s1c1
Sequence:CCGGCCTGAGAAACAACACTGTCATCTCGAGATGACAGTGTTGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-169s1c1
Sequence:CCGGCGCTGGTTTATACTTCGGAGTCTCGAGACTCCGAAGTATAAACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-998s1c1
Sequence:CCGGTGGACAATATGGATGTCCCAACTCGAGTTGGGACATCCATATTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-831s1c1
Sequence:CCGGCCGACACAATACAGAATTCAACTCGAGTTGAATTCTGTATTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010248
GAB2 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-573s1c1
Sequence:CCGGCCAGCCTACTTTATTCACGTTCTCGAGAACGTGAATAAAGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-1629s1c1
Sequence:CCGGCCTGAGAAACAACACTGTCATCTCGAGATGACAGTGTTGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-169s1c1
Sequence:CCGGCGCTGGTTTATACTTCGGAGTCTCGAGACTCCGAAGTATAAACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-998s1c1
Sequence:CCGGTGGACAATATGGATGTCCCAACTCGAGTTGGGACATCCATATTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-831s1c1
Sequence:CCGGCCGACACAATACAGAATTCAACTCGAGTTGAATTCTGTATTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010248
GAB2 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-573s1c1
Sequence:CCGGCCAGCCTACTTTATTCACGTTCTCGAGAACGTGAATAAAGTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-1629s1c1
Sequence:CCGGCCTGAGAAACAACACTGTCATCTCGAGATGACAGTGTTGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-169s1c1
Sequence:CCGGCGCTGGTTTATACTTCGGAGTCTCGAGACTCCGAAGTATAAACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-998s1c1
Sequence:CCGGTGGACAATATGGATGTCCCAACTCGAGTTGGGACATCCATATTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010248.1-831s1c1
Sequence:CCGGCCGACACAATACAGAATTCAACTCGAGTTGAATTCTGTATTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks