EMAIL THIS PAGE TO A FRIEND

GAB3

GRB2-associated binding protein 3

185 Gene Product Result for
UniProtKB ID: Q8WWW8, E9PB44
Gene ID:
Human(139716) Summary: This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(210710) growth factor receptor bound protein 2-associated protein 3
chicken(428717) GRB2-associated binding protein 3
dog(492262) GRB2-associated binding protein 3
cow(512009) GRB2-associated binding protein 3
Horse(100063152) GRB2-associated binding protein 3
domestic cat(101095807) GRB2-associated binding protein 3
naked mole-rat(101724701) GRB2-associated binding protein 3
domestic guinea pig(100732341) GRB2-associated binding protein 3
sheep(101114497) GRB2-associated binding protein 3
Domestic Rabbit(100328766) GRB2-associated binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081573 Rosetta Predictions human pricing
NM_080612 Rosetta Predictions human pricing
NM_153073 Rosetta Predictions mouse pricing
NM_181584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316463 predicted 1505
2 SASI_Hs02_00316464 predicted 854
3 SASI_Hs02_00316465 predicted 1070
4 SASI_Hs02_00316466 predicted 1287
5 SASI_Hs02_00316467 predicted 896
6 SASI_Hs02_00316468 predicted 690
7 SASI_Hs02_00316469 predicted 1048
8 SASI_Hs02_00316470 predicted 675
9 SASI_Hs02_00316471 predicted 649
10 SASI_Hs02_00316472 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059497 predicted 1501
2 SASI_Hs01_00059498 predicted 844
3 SASI_Hs01_00059499 predicted 1070
4 SASI_Hs02_00362360 predicted 1288
5 SASI_Hs01_00059500 predicted 884
6 SASI_Hs02_00362361 predicted 689
7 SASI_Hs01_00059501 predicted 1046
8 SASI_Hs01_00059502 predicted 673
9 SASI_Hs01_00059503 predicted 647
10 SASI_Hs01_00059505 predicted 665
11 SASI_Hs01_00059496 predicted 1612
12 SASI_Hs01_00059504 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032944 predicted 211
2 SASI_Mm01_00032945 predicted 725
3 SASI_Mm01_00032946 predicted 257
4 SASI_Mm01_00032947 predicted 252
5 SASI_Mm01_00032948 predicted 302
6 SASI_Mm01_00032949 predicted 254
7 SASI_Mm01_00032950 predicted 250
8 SASI_Mm02_00342898 predicted 208
9 SASI_Mm01_00032951 predicted 256
10 SASI_Mm02_00342899 predicted 196
11 SASI_Mm01_00032943 predicted 301
12 SASI_Mm01_00032952 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158199 predicted 333
2 SASI_Mm01_00158200 predicted 839
3 SASI_Mm01_00158201 predicted 370
4 SASI_Mm01_00158202 predicted 375
5 SASI_Mm01_00158203 predicted 418
6 SASI_Mm01_00158204 predicted 370
7 SASI_Mm01_00158205 predicted 365
8 SASI_Mm01_00158206 predicted 315
9 SASI_Mm01_00158207 predicted 371
10 SASI_Mm01_00158208 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080612
GAB3 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080612.2-2115s21c1
Sequence:CCGGTTGACTCCAATACCTGAAATTCTCGAGAATTTCAGGTATTGGAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080612.2-1073s21c1
Sequence:CCGGGAATCTCCCTCTCTGGTTTAGCTCGAGCTAAACCAGAGAGGGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-836s1c1
Sequence:CCGGCCACTTGTCTTCTTCACCATTCTCGAGAATGGTGAAGAAGACAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-1133s1c1
Sequence:CCGGCAAGCGGCTTAGTTTGAATTTCTCGAGAAATTCAAACTAAGCCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080612.1-2904s1c1
Sequence:CCGGGCAGACACAATGACCAGGAAACTCGAGTTTCCTGGTCATTGTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080612.1-510s1c1
Sequence:CCGGGACCCAAACACTAATGCCGTACTCGAGTACGGCATTAGTGTTTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-1262s1c1
Sequence:CCGGCCCTGATGACTACATTCCAATCTCGAGATTGGAATGTAGTCATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-296s1c1
Sequence:CCGGCAAGACTACTTCCCGTACATTCTCGAGAATGTACGGGAAGTAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080612.1-1596s1c1
Sequence:CCGGGCCCTTACGTGGACAAAGAAACTCGAGTTTCTTTGTCCACGTAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080612
GAB3 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080612.2-2115s21c1
Sequence:CCGGTTGACTCCAATACCTGAAATTCTCGAGAATTTCAGGTATTGGAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080612.2-1073s21c1
Sequence:CCGGGAATCTCCCTCTCTGGTTTAGCTCGAGCTAAACCAGAGAGGGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-836s1c1
Sequence:CCGGCCACTTGTCTTCTTCACCATTCTCGAGAATGGTGAAGAAGACAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-1133s1c1
Sequence:CCGGCAAGCGGCTTAGTTTGAATTTCTCGAGAAATTCAAACTAAGCCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080612.1-2904s1c1
Sequence:CCGGGCAGACACAATGACCAGGAAACTCGAGTTTCCTGGTCATTGTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080612.1-510s1c1
Sequence:CCGGGACCCAAACACTAATGCCGTACTCGAGTACGGCATTAGTGTTTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-1262s1c1
Sequence:CCGGCCCTGATGACTACATTCCAATCTCGAGATTGGAATGTAGTCATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-296s1c1
Sequence:CCGGCAAGACTACTTCCCGTACATTCTCGAGAATGTACGGGAAGTAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080612.1-1596s1c1
Sequence:CCGGGCCCTTACGTGGACAAAGAAACTCGAGTTTCTTTGTCCACGTAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080612
GAB3 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080612.2-2115s21c1
Sequence:CCGGTTGACTCCAATACCTGAAATTCTCGAGAATTTCAGGTATTGGAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080612.2-1073s21c1
Sequence:CCGGGAATCTCCCTCTCTGGTTTAGCTCGAGCTAAACCAGAGAGGGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-836s1c1
Sequence:CCGGCCACTTGTCTTCTTCACCATTCTCGAGAATGGTGAAGAAGACAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-1133s1c1
Sequence:CCGGCAAGCGGCTTAGTTTGAATTTCTCGAGAAATTCAAACTAAGCCGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080612.1-2904s1c1
Sequence:CCGGGCAGACACAATGACCAGGAAACTCGAGTTTCCTGGTCATTGTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080612.1-510s1c1
Sequence:CCGGGACCCAAACACTAATGCCGTACTCGAGTACGGCATTAGTGTTTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-1262s1c1
Sequence:CCGGCCCTGATGACTACATTCCAATCTCGAGATTGGAATGTAGTCATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080612.1-296s1c1
Sequence:CCGGCAAGACTACTTCCCGTACATTCTCGAGAATGTACGGGAAGTAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080612.1-1596s1c1
Sequence:CCGGGCCCTTACGTGGACAAAGAAACTCGAGTTTCTTTGTCCACGTAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153073
GAB3 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153073.1-1867s1c1
Sequence:CCGGGCCTTTATTTCTAAGTTCTCTCTCGAGAGAGAACTTAGAAATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-224s1c1
Sequence:CCGGCGTGTGATAGACCTCAGTGAACTCGAGTTCACTGAGGTCTATCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-896s1c1
Sequence:CCGGCCCACAGTTCATGTAGAAGAACTCGAGTTCTTCTACATGAACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-654s1c1
Sequence:CCGGCCAGATGTGATAGCTGGTCAACTCGAGTTGACCAGCTATCACATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-655s1c1
Sequence:CCGGCAGATGTGATAGCTGGTCAAACTCGAGTTTGACCAGCTATCACATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153073
GAB3 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153073.1-1867s1c1
Sequence:CCGGGCCTTTATTTCTAAGTTCTCTCTCGAGAGAGAACTTAGAAATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-224s1c1
Sequence:CCGGCGTGTGATAGACCTCAGTGAACTCGAGTTCACTGAGGTCTATCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-896s1c1
Sequence:CCGGCCCACAGTTCATGTAGAAGAACTCGAGTTCTTCTACATGAACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-654s1c1
Sequence:CCGGCCAGATGTGATAGCTGGTCAACTCGAGTTGACCAGCTATCACATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-655s1c1
Sequence:CCGGCAGATGTGATAGCTGGTCAAACTCGAGTTTGACCAGCTATCACATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153073
GAB3 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153073.1-1867s1c1
Sequence:CCGGGCCTTTATTTCTAAGTTCTCTCTCGAGAGAGAACTTAGAAATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-224s1c1
Sequence:CCGGCGTGTGATAGACCTCAGTGAACTCGAGTTCACTGAGGTCTATCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-896s1c1
Sequence:CCGGCCCACAGTTCATGTAGAAGAACTCGAGTTCTTCTACATGAACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-654s1c1
Sequence:CCGGCCAGATGTGATAGCTGGTCAACTCGAGTTGACCAGCTATCACATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153073.1-655s1c1
Sequence:CCGGCAGATGTGATAGCTGGTCAAACTCGAGTTTGACCAGCTATCACATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)