EMAIL THIS PAGE TO A FRIEND

GAB4

GRB2-associated binding protein family, member 4

17 Gene Product Result for
Species: Human GAB4(128954)
UniProtKB ID: Q2WGN9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037814 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037814 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037814 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037814 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235196 predicted 1887
2 SASI_Hs01_00235197 predicted 454
3 SASI_Hs01_00235198 predicted 439
4 SASI_Hs01_00235199 predicted 450
5 SASI_Hs01_00235200 predicted 1712
6 SASI_Hs02_00308378 predicted 1882
7 SASI_Hs01_00235202 predicted 1414
8 SASI_Hs01_00235203 predicted 270
9 SASI_Hs01_00235204 predicted 1269
10 SASI_Hs01_00235205 predicted 221
11 SASI_Hs01_00235201 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037814
GAB4 MISSION shRNA Bacterial Glycerol Stock
GRB2-associated binding protein family, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037814.1-2284s21c1
Sequence:CCGGAGTTGAGAAGGAAGGTTAAAGCTCGAGCTTTAACCTTCCTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-448s21c1
Sequence:CCGGGAGATTCAGAAGGGCTATATGCTCGAGCATATAGCCCTTCTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1421s21c1
Sequence:CCGGGAAACAACAGGGTCATCAATGCTCGAGCATTGATGACCCTGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1224s21c1
Sequence:CCGGGAAGCAAGCAGGCGATGATTCCTCGAGGAATCATCGCCTGCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1021s21c1
Sequence:CCGGACAGGCTCTGAGGCGGATAATCTCGAGATTATCCGCCTCAGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037814
GAB4 MISSION shRNA shRNA Plasmid DNA
GRB2-associated binding protein family, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037814.1-2284s21c1
Sequence:CCGGAGTTGAGAAGGAAGGTTAAAGCTCGAGCTTTAACCTTCCTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-448s21c1
Sequence:CCGGGAGATTCAGAAGGGCTATATGCTCGAGCATATAGCCCTTCTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1421s21c1
Sequence:CCGGGAAACAACAGGGTCATCAATGCTCGAGCATTGATGACCCTGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1224s21c1
Sequence:CCGGGAAGCAAGCAGGCGATGATTCCTCGAGGAATCATCGCCTGCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1021s21c1
Sequence:CCGGACAGGCTCTGAGGCGGATAATCTCGAGATTATCCGCCTCAGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037814
GAB4 MISSION shRNA Lentiviral Transduction Particles
GRB2-associated binding protein family, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037814.1-2284s21c1
Sequence:CCGGAGTTGAGAAGGAAGGTTAAAGCTCGAGCTTTAACCTTCCTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-448s21c1
Sequence:CCGGGAGATTCAGAAGGGCTATATGCTCGAGCATATAGCCCTTCTGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1421s21c1
Sequence:CCGGGAAACAACAGGGTCATCAATGCTCGAGCATTGATGACCCTGTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1224s21c1
Sequence:CCGGGAAGCAAGCAGGCGATGATTCCTCGAGGAATCATCGCCTGCTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037814.1-1021s21c1
Sequence:CCGGACAGGCTCTGAGGCGGATAATCTCGAGATTATCCGCCTCAGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks