EMAIL THIS PAGE TO A FRIEND

GABARAP

GABA(A) receptor-associated protein

Synonyms: ATG8A GABARAP-a MM46
UniProtKB ID: O95166
Gene ID:
Human(11337) Summary: Gamma-aminobutyric acid A receptors [GABA(A) receptors]
Mouse(56486) gamma-aminobutyric acid receptor associated protein
Rat(58974) GABA(A) receptor-associated protein
cow(327715) GABA(A) receptor-associated protein
domestic cat(101094636) GABA(A) receptor-associated protein
dog(479479) GABA(A) receptor-associated protein
sheep(101118285) GABA(A) receptor-associated protein
Domestic Rabbit(100008883) GABA(A) receptor-associated protein
naked mole-rat(101711840) GABA(A) receptor-associated protein
Gene Class: Cytoskeleton
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007278 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007278 Rosetta Predictions human pricing
NM_172036 Rosetta Predictions rat pricing
NM_019749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197526 predicted 433
2 SASI_Hs02_00343333 predicted 384
3 SASI_Hs02_00343334 predicted 392
4 SASI_Hs01_00197520 predicted 369
5 SASI_Hs01_00197521 predicted 626
6 SASI_Hs01_00197522 predicted 549
7 SASI_Hs01_00197523 predicted 437
8 SASI_Hs01_00197524 predicted 368
9 SASI_Hs01_00197525 predicted 627
10 SASI_Hs01_00197527 predicted 525
11 SASI_Hs01_00197528 predicted 307
12 SASI_Hs01_00197529 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054391 predicted 346
2 SASI_Rn01_00054392 predicted 204
3 SASI_Rn01_00054393 predicted 346
4 SASI_Rn01_00054394 predicted 252
5 SASI_Rn01_00054395 predicted 249
6 SASI_Rn01_00054396 predicted 421
7 SASI_Rn01_00054397 predicted 484
8 SASI_Rn01_00054398 predicted 344
9 SASI_Rn01_00054399 predicted 389
10 SASI_Rn01_00054400 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075055 predicted 644
2 SASI_Mm01_00075056 predicted 623
3 SASI_Mm01_00075057 predicted 692
4 SASI_Mm01_00075058 predicted 637
5 SASI_Mm01_00075059 predicted 545
6 SASI_Mm01_00075061 predicted 865
7 SASI_Mm01_00075062 predicted 640
8 SASI_Mm01_00075063 predicted 635
9 SASI_Mm01_00075064 predicted 561
10 SASI_Mm02_00324912 predicted 518
11 SASI_Mm01_00075060 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019749
VALIDATED
GABARAP MISSION shRNA Bacterial Glycerol Stock
GABA(A) receptor-associated protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019749.4-660s21c1
Sequence:GTACCGGACATTGCCTACAGTGATGAAACTCGAGTTTCATCACTGTAGGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-542s21c1
Sequence:CCGGCGAATTCATCTCCGTGCTGAACTCGAGTTCAGCACGGAGATGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019749.4-554s21c1
Sequence:CCGGCGTGCTGAAGATGCCTTGTTTCTCGAGAAACAAGGCATCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-636s21c1
Sequence:CCGGACCATGAAGAAGACTTCTTTCCTCGAGGAAAGAAGTCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-576s21c1
Sequence:CCGGTCTTTGTCAACAATGTCATTCCTCGAGGAATGACATTGTTGACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-943s21c1
Sequence:CCGGCTCTGTCACATCCGATGATTGCTCGAGCAATCATCGGATGTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019749.4-765s21c1
Sequence:GTACCGGGTTCCTCCTTCAGGCTCAAACCTCGAGGTTTGAGCCTGAAGGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-921s1c1
Sequence:CCGGCCACTCTGATTTAGACTTCTTCTCGAGAAGAAGTCTAAATCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-551s1c1
Sequence:CCGGCGAATTCATCTCCGTGCTGAACTCGAGTTCAGCACGGAGATGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019749.3-392s1c1
Sequence:CCGGCGCCGCTCTGAGGGCGAGAAACTCGAGTTTCTCGCCCTCAGAGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-563s1c1
Sequence:CCGGCGTGCTGAAGATGCCTTGTTTCTCGAGAAACAAGGCATCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-510s1c1
Sequence:CCGGCTGATCTTACAGTTGGTCAATCTCGAGATTGACCAACTGTAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019749
VALIDATED
GABARAP MISSION shRNA shRNA Plasmid DNA
GABA(A) receptor-associated protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019749.4-660s21c1
Sequence:GTACCGGACATTGCCTACAGTGATGAAACTCGAGTTTCATCACTGTAGGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-542s21c1
Sequence:CCGGCGAATTCATCTCCGTGCTGAACTCGAGTTCAGCACGGAGATGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019749.4-554s21c1
Sequence:CCGGCGTGCTGAAGATGCCTTGTTTCTCGAGAAACAAGGCATCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-636s21c1
Sequence:CCGGACCATGAAGAAGACTTCTTTCCTCGAGGAAAGAAGTCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-576s21c1
Sequence:CCGGTCTTTGTCAACAATGTCATTCCTCGAGGAATGACATTGTTGACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-943s21c1
Sequence:CCGGCTCTGTCACATCCGATGATTGCTCGAGCAATCATCGGATGTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019749.4-765s21c1
Sequence:GTACCGGGTTCCTCCTTCAGGCTCAAACCTCGAGGTTTGAGCCTGAAGGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-921s1c1
Sequence:CCGGCCACTCTGATTTAGACTTCTTCTCGAGAAGAAGTCTAAATCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-551s1c1
Sequence:CCGGCGAATTCATCTCCGTGCTGAACTCGAGTTCAGCACGGAGATGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019749.3-392s1c1
Sequence:CCGGCGCCGCTCTGAGGGCGAGAAACTCGAGTTTCTCGCCCTCAGAGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-563s1c1
Sequence:CCGGCGTGCTGAAGATGCCTTGTTTCTCGAGAAACAAGGCATCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-510s1c1
Sequence:CCGGCTGATCTTACAGTTGGTCAATCTCGAGATTGACCAACTGTAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019749
VALIDATED
GABARAP MISSION shRNA Lentiviral Transduction Particles
GABA(A) receptor-associated protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019749.4-660s21c1
Sequence:GTACCGGACATTGCCTACAGTGATGAAACTCGAGTTTCATCACTGTAGGCAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-542s21c1
Sequence:CCGGCGAATTCATCTCCGTGCTGAACTCGAGTTCAGCACGGAGATGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019749.4-554s21c1
Sequence:CCGGCGTGCTGAAGATGCCTTGTTTCTCGAGAAACAAGGCATCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-636s21c1
Sequence:CCGGACCATGAAGAAGACTTCTTTCCTCGAGGAAAGAAGTCTTCTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-576s21c1
Sequence:CCGGTCTTTGTCAACAATGTCATTCCTCGAGGAATGACATTGTTGACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019749.4-943s21c1
Sequence:CCGGCTCTGTCACATCCGATGATTGCTCGAGCAATCATCGGATGTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019749.4-765s21c1
Sequence:GTACCGGGTTCCTCCTTCAGGCTCAAACCTCGAGGTTTGAGCCTGAAGGAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-921s1c1
Sequence:CCGGCCACTCTGATTTAGACTTCTTCTCGAGAAGAAGTCTAAATCAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-551s1c1
Sequence:CCGGCGAATTCATCTCCGTGCTGAACTCGAGTTCAGCACGGAGATGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019749.3-392s1c1
Sequence:CCGGCGCCGCTCTGAGGGCGAGAAACTCGAGTTTCTCGCCCTCAGAGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-563s1c1
Sequence:CCGGCGTGCTGAAGATGCCTTGTTTCTCGAGAAACAAGGCATCTTCAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019749.3-510s1c1
Sequence:CCGGCTGATCTTACAGTTGGTCAATCTCGAGATTGACCAACTGTAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007278
VALIDATED
GABARAP MISSION shRNA Bacterial Glycerol Stock
GABA(A) receptor-associated protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-544s21c1
Sequence:CCGGCAAACACCACCTCCCTTATTCCTCGAGGAATAAGGGAGGTGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-255s21c1
Sequence:CCGGGTGCCTTCTGATCTCACAGTTCTCGAGAACTGTGAGATCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-396s21c1
Sequence:CCGGCACCATGAAGAAGACTTCTTTCTCGAGAAAGAAGTCTTCTTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-222s21c1
Sequence:CCGGCGGATAGGAGACCTGGACAAACTCGAGTTTGTCCAGGTCTCCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-422s21c1
Sequence:CCGGCATTGCCTACAGTGACGAAAGCTCGAGCTTTCGTCACTGTAGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007278.1-625s21c1
Sequence:GTACCGGGTGGAGTTGGCATCTTGTAACCTCGAGGTTACAAGATGCCAACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007278.1-337s21c1
Sequence:GTACCGGTCTTTGTCAACAATGTCATTCCTCGAGGAATGACATTGTTGACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007278.1-187s21c1
Sequence:GTACCGGGGGTGCCGGTGATAGTAGAAACTCGAGTTTCTACTATCACCGGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-396s1c1
Sequence:CCGGCACCATGAAGAAGACTTCTTTCTCGAGAAAGAAGTCTTCTTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-255s1c1
Sequence:CCGGGTGCCTTCTGATCTCACAGTTCTCGAGAACTGTGAGATCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007278.1-384s1c1
Sequence:CCGGCTGTACCAGGAACACCATGAACTCGAGTTCATGGTGTTCCTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-222s1c1
Sequence:CCGGCGGATAGGAGACCTGGACAAACTCGAGTTTGTCCAGGTCTCCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007278
VALIDATED
GABARAP MISSION shRNA shRNA Plasmid DNA
GABA(A) receptor-associated protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-544s21c1
Sequence:CCGGCAAACACCACCTCCCTTATTCCTCGAGGAATAAGGGAGGTGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-255s21c1
Sequence:CCGGGTGCCTTCTGATCTCACAGTTCTCGAGAACTGTGAGATCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-396s21c1
Sequence:CCGGCACCATGAAGAAGACTTCTTTCTCGAGAAAGAAGTCTTCTTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-222s21c1
Sequence:CCGGCGGATAGGAGACCTGGACAAACTCGAGTTTGTCCAGGTCTCCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-422s21c1
Sequence:CCGGCATTGCCTACAGTGACGAAAGCTCGAGCTTTCGTCACTGTAGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007278.1-625s21c1
Sequence:GTACCGGGTGGAGTTGGCATCTTGTAACCTCGAGGTTACAAGATGCCAACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007278.1-337s21c1
Sequence:GTACCGGTCTTTGTCAACAATGTCATTCCTCGAGGAATGACATTGTTGACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007278.1-187s21c1
Sequence:GTACCGGGGGTGCCGGTGATAGTAGAAACTCGAGTTTCTACTATCACCGGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-396s1c1
Sequence:CCGGCACCATGAAGAAGACTTCTTTCTCGAGAAAGAAGTCTTCTTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-255s1c1
Sequence:CCGGGTGCCTTCTGATCTCACAGTTCTCGAGAACTGTGAGATCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007278.1-384s1c1
Sequence:CCGGCTGTACCAGGAACACCATGAACTCGAGTTCATGGTGTTCCTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-222s1c1
Sequence:CCGGCGGATAGGAGACCTGGACAAACTCGAGTTTGTCCAGGTCTCCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007278
VALIDATED
GABARAP MISSION shRNA Lentiviral Transduction Particles
GABA(A) receptor-associated protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-544s21c1
Sequence:CCGGCAAACACCACCTCCCTTATTCCTCGAGGAATAAGGGAGGTGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-255s21c1
Sequence:CCGGGTGCCTTCTGATCTCACAGTTCTCGAGAACTGTGAGATCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-396s21c1
Sequence:CCGGCACCATGAAGAAGACTTCTTTCTCGAGAAAGAAGTCTTCTTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-222s21c1
Sequence:CCGGCGGATAGGAGACCTGGACAAACTCGAGTTTGTCCAGGTCTCCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007278.1-422s21c1
Sequence:CCGGCATTGCCTACAGTGACGAAAGCTCGAGCTTTCGTCACTGTAGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007278.1-625s21c1
Sequence:GTACCGGGTGGAGTTGGCATCTTGTAACCTCGAGGTTACAAGATGCCAACTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007278.1-337s21c1
Sequence:GTACCGGTCTTTGTCAACAATGTCATTCCTCGAGGAATGACATTGTTGACAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007278.1-187s21c1
Sequence:GTACCGGGGGTGCCGGTGATAGTAGAAACTCGAGTTTCTACTATCACCGGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-396s1c1
Sequence:CCGGCACCATGAAGAAGACTTCTTTCTCGAGAAAGAAGTCTTCTTCATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-255s1c1
Sequence:CCGGGTGCCTTCTGATCTCACAGTTCTCGAGAACTGTGAGATCAGAAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007278.1-384s1c1
Sequence:CCGGCTGTACCAGGAACACCATGAACTCGAGTTCATGGTGTTCCTGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_007278.1-222s1c1
Sequence:CCGGCGGATAGGAGACCTGGACAAACTCGAGTTTGTCCAGGTCTCCTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks