EMAIL THIS PAGE TO A FRIEND

GABARAPL1

GABA(A) receptor-associated protein like 1

153 Gene Product Result for
Synonyms: APG8-LIKE APG8L ATG8 ATG8B ATG8L GEC1
UniProtKB ID: Q9H0R8, B4E0Y7, Q6FIE6
Gene ID:
Mouse(57436) gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1
Rat(689161) GABA(A) receptor-associated protein like 1
chicken(769118) GABA(A) receptor-associated protein like 1
dog(612919) GABA(A) receptor-associated protein like 1
cow(338472) GABA(A) receptor-associated protein like 1
domestic cat(101083945) GABA(A) receptor-associated protein like 1
naked mole-rat(101710547) GABA(A) receptor-associated protein like 1
domestic guinea pig(100135524) gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1
sheep(101117406) GABA(A) receptor-associated protein like 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031412 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107971 MISSION® esiRNA esiRNA human GABARAPL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031412 Rosetta Predictions human pricing
NM_001044294 Rosetta Predictions rat pricing
NM_020590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200246 predicted 841
2 SASI_Hs01_00200247 predicted 726
3 SASI_Hs01_00200248 predicted 871
4 SASI_Hs01_00200249 predicted 527
5 SASI_Hs01_00200250 predicted 403
6 SASI_Hs01_00200251 predicted 837
7 SASI_Hs01_00200252 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205614 predicted 893
2 SASI_Rn02_00205615 predicted 969
3 SASI_Rn02_00205616 predicted 506
4 SASI_Rn02_00205617 predicted 331
5 SASI_Rn02_00205618 predicted 378
6 SASI_Rn02_00205619 predicted 788
7 SASI_Rn02_00205620 predicted 955
8 SASI_Rn02_00205621 predicted 381
9 SASI_Rn02_00205622 predicted 720
10 SASI_Rn02_00205623 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176436 predicted 918
2 SASI_Mm01_00176437 predicted 846
3 SASI_Mm01_00176438 predicted 1048
4 SASI_Mm01_00176439 predicted 408
5 SASI_Mm01_00176440 predicted 461
6 SASI_Mm01_00176441 predicted 377
7 SASI_Mm01_00176442 predicted 878
8 SASI_Mm01_00176443 predicted 581
9 SASI_Mm01_00176444 predicted 935
10 SASI_Mm01_00176445 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020590
VALIDATED
GABARAPL1 MISSION shRNA Bacterial Glycerol Stock
GABA(A) receptor-associated protein like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-1226s1c1
Sequence:CCGGCGGTTATGATTGCCAGCGTTTCTCGAGAAACGCTGGCAATCATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-382s1c1
Sequence:CCGGTGATCTGGATAAGAGGAAGTACTCGAGTACTTCCTCTTATCCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020590.3-316s1c1
Sequence:CCGGGATTAGGAAGAAATACCCGGACTCGAGTCCGGGTATTTCTTCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-546s1c1
Sequence:CCGGACAACCACGAGGAAGACTATTCTCGAGAATAGTCTTCCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-427s1c1
Sequence:CCGGTGGCCAGTTCTACTTCTTAATCTCGAGATTAAGAAGTAGAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-426s21c1
Sequence:CCGGTGGCCAGTTCTACTTCTTAATCTCGAGATTAAGAAGTAGAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-465s21c1
Sequence:CCGGGAGACCTGAGGACGCCTTATTCTCGAGAATAAGGCGTCCTCAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-349s21c1
Sequence:CCGGATCGTGGAGAAGGCTCCTAAACTCGAGTTTAGGAGCCTTCTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-545s21c1
Sequence:CCGGACAACCACGAGGAAGACTATTCTCGAGAATAGTCTTCCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020590
VALIDATED
GABARAPL1 MISSION shRNA shRNA Plasmid DNA
GABA(A) receptor-associated protein like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-1226s1c1
Sequence:CCGGCGGTTATGATTGCCAGCGTTTCTCGAGAAACGCTGGCAATCATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-382s1c1
Sequence:CCGGTGATCTGGATAAGAGGAAGTACTCGAGTACTTCCTCTTATCCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020590.3-316s1c1
Sequence:CCGGGATTAGGAAGAAATACCCGGACTCGAGTCCGGGTATTTCTTCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-546s1c1
Sequence:CCGGACAACCACGAGGAAGACTATTCTCGAGAATAGTCTTCCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-427s1c1
Sequence:CCGGTGGCCAGTTCTACTTCTTAATCTCGAGATTAAGAAGTAGAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-426s21c1
Sequence:CCGGTGGCCAGTTCTACTTCTTAATCTCGAGATTAAGAAGTAGAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-465s21c1
Sequence:CCGGGAGACCTGAGGACGCCTTATTCTCGAGAATAAGGCGTCCTCAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-349s21c1
Sequence:CCGGATCGTGGAGAAGGCTCCTAAACTCGAGTTTAGGAGCCTTCTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-545s21c1
Sequence:CCGGACAACCACGAGGAAGACTATTCTCGAGAATAGTCTTCCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020590
VALIDATED
GABARAPL1 MISSION shRNA Lentiviral Transduction Particles
GABA(A) receptor-associated protein like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-1226s1c1
Sequence:CCGGCGGTTATGATTGCCAGCGTTTCTCGAGAAACGCTGGCAATCATAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-382s1c1
Sequence:CCGGTGATCTGGATAAGAGGAAGTACTCGAGTACTTCCTCTTATCCAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020590.3-316s1c1
Sequence:CCGGGATTAGGAAGAAATACCCGGACTCGAGTCCGGGTATTTCTTCCTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-546s1c1
Sequence:CCGGACAACCACGAGGAAGACTATTCTCGAGAATAGTCTTCCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020590.3-427s1c1
Sequence:CCGGTGGCCAGTTCTACTTCTTAATCTCGAGATTAAGAAGTAGAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-426s21c1
Sequence:CCGGTGGCCAGTTCTACTTCTTAATCTCGAGATTAAGAAGTAGAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-465s21c1
Sequence:CCGGGAGACCTGAGGACGCCTTATTCTCGAGAATAAGGCGTCCTCAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-349s21c1
Sequence:CCGGATCGTGGAGAAGGCTCCTAAACTCGAGTTTAGGAGCCTTCTCCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020590.4-545s21c1
Sequence:CCGGACAACCACGAGGAAGACTATTCTCGAGAATAGTCTTCCTCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031412
GABARAPL1 MISSION shRNA Bacterial Glycerol Stock
GABA(A) receptor-associated protein like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-503s1c1
Sequence:CCGGCGCCTTATTCTTCTTTGTCAACTCGAGTTGACAAAGAAGAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-369s1c1
Sequence:CCGGCCCGTGATTGTAGAGAAGGCTCTCGAGAGCCTTCTCTACAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-570s1c1
Sequence:CCGGGACAATCATGAGGAAGACTATCTCGAGATAGTCTTCCTCATGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-443s1c1
Sequence:CCGGCCTTACTGTTGGCCAGTTCTACTCGAGTAGAACTGGCCAACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-558s1c1
Sequence:CCGGCAACTGTATGAGGACAATCATCTCGAGATGATTGTCCTCATACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031412.2-846s21c1
Sequence:CCGGTGATGTAAGTTTACAGTATTCCTCGAGGAATACTGTAAACTTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031412.2-566s21c1
Sequence:CCGGACAGTGATGAGAGTGTCTATGCTCGAGCATAGACACTCTCATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031412
GABARAPL1 MISSION shRNA shRNA Plasmid DNA
GABA(A) receptor-associated protein like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-503s1c1
Sequence:CCGGCGCCTTATTCTTCTTTGTCAACTCGAGTTGACAAAGAAGAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-369s1c1
Sequence:CCGGCCCGTGATTGTAGAGAAGGCTCTCGAGAGCCTTCTCTACAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-570s1c1
Sequence:CCGGGACAATCATGAGGAAGACTATCTCGAGATAGTCTTCCTCATGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-443s1c1
Sequence:CCGGCCTTACTGTTGGCCAGTTCTACTCGAGTAGAACTGGCCAACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-558s1c1
Sequence:CCGGCAACTGTATGAGGACAATCATCTCGAGATGATTGTCCTCATACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031412.2-846s21c1
Sequence:CCGGTGATGTAAGTTTACAGTATTCCTCGAGGAATACTGTAAACTTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031412.2-566s21c1
Sequence:CCGGACAGTGATGAGAGTGTCTATGCTCGAGCATAGACACTCTCATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031412
GABARAPL1 MISSION shRNA Lentiviral Transduction Particles
GABA(A) receptor-associated protein like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-503s1c1
Sequence:CCGGCGCCTTATTCTTCTTTGTCAACTCGAGTTGACAAAGAAGAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-369s1c1
Sequence:CCGGCCCGTGATTGTAGAGAAGGCTCTCGAGAGCCTTCTCTACAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-570s1c1
Sequence:CCGGGACAATCATGAGGAAGACTATCTCGAGATAGTCTTCCTCATGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-443s1c1
Sequence:CCGGCCTTACTGTTGGCCAGTTCTACTCGAGTAGAACTGGCCAACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031412.1-558s1c1
Sequence:CCGGCAACTGTATGAGGACAATCATCTCGAGATGATTGTCCTCATACAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031412.2-846s21c1
Sequence:CCGGTGATGTAAGTTTACAGTATTCCTCGAGGAATACTGTAAACTTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031412.2-566s21c1
Sequence:CCGGACAGTGATGAGAGTGTCTATGCTCGAGCATAGACACTCTCATCACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks