EMAIL THIS PAGE TO A FRIEND

GABBR1

gamma-aminobutyric acid (GABA) B receptor, 1

156 Gene Product Result for
Synonyms: GABABR1 GABBR1-3 GB1 GPRC3A dJ271M21.1.1 dJ271M21.1.2
Gene ID:
Human(2550) Summary: Gamma-aminobutyric acid (GABA) is the main inhibitory neurotransmitter in the mammalian central nervous system. GABA exerts its effects through ionotropic [GABA(A/C)]
Mouse(54393) gamma-aminobutyric acid (GABA) B receptor, 1
Rat(81657) gamma-aminobutyric acid (GABA) B receptor 1
domestic cat(101099637) gamma-aminobutyric acid (GABA) B receptor, 1
dog(488340) gamma-aminobutyric acid (GABA) B receptor, 1
cow(513785) gamma-aminobutyric acid (GABA) B receptor, 1
sheep(101110007) gamma-aminobutyric acid (GABA) B receptor, 1
Domestic Rabbit(100353026) gamma-aminobutyric acid (GABA) B receptor, 1
naked mole-rat(101719480) gamma-aminobutyric acid (GABA) B receptor, 1
domestic guinea pig(100170763) gamma-aminobutyric acid (GABA) B receptor, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501062 Anti-GABA-B Receptor, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
G1295 Anti-GABAB Receptor 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
HPA050483 Anti-GABBR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501063 Anti-GABBR1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB5200429 Monoclonal Anti-Gaba-B Receptor 1 - Alkaline Phosphatase antibody produced in mouse clone S93A-49, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5200430 Monoclonal Anti-Gaba-B Receptor 1 - Apc antibody produced in mouse clone S93A-49, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200421 Monoclonal Anti-Gaba-B Receptor 1 - Atto 390 antibody produced in mouse clone S93A-49, purified immunoglobulin human, rat, mouse
western blot pricing
SAB5200422 Monoclonal Anti-Gaba-B Receptor 1 - Atto 488 antibody produced in mouse clone S93A-49, purified immunoglobulin human, rat, mouse
western blot pricing
SAB5200423 Monoclonal Anti-Gaba-B Receptor 1 - Atto 565 antibody produced in mouse clone S93A-49, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200424 Monoclonal Anti-Gaba-B Receptor 1 - Atto 594 antibody produced in mouse clone S93A-49, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5200425 Monoclonal Anti-Gaba-B Receptor 1 - Atto 633 antibody produced in mouse clone S93A-49, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200426 Monoclonal Anti-Gaba-B Receptor 1 - Atto 655 antibody produced in mouse clone S93A-49, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5200427 Monoclonal Anti-Gaba-B Receptor 1 - Atto 680 antibody produced in mouse clone S93A-49, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200428 Monoclonal Anti-Gaba-B Receptor 1 - Atto 700 antibody produced in mouse clone S93A-49, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200431 Monoclonal Anti-Gaba-B Receptor 1 - Biotin antibody produced in mouse clone S93A-49, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200432 Monoclonal Anti-Gaba-B Receptor 1 - Fitc antibody produced in mouse clone S93A-49, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5200433 Monoclonal Anti-Gaba-B Receptor 1 - Hrp antibody produced in mouse clone S93A-49, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5200434 Monoclonal Anti-Gaba-B Receptor 1 - Pe/Atto 594 antibody produced in mouse clone S93A-49, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5200435 Monoclonal Anti-Gaba-B Receptor 1 - Percp antibody produced in mouse clone S93A-49, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200436 Monoclonal Anti-Gaba-B Receptor 1 - Rpe antibody produced in mouse clone S93A-49, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200437 Monoclonal Anti-Gaba-B Receptor 1 - Streptavidin antibody produced in mouse clone S93A-49, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5200420 Monoclonal Anti-Gaba-B Receptor 1 antibody produced in mouse clone S93A-49, purified immunoglobulin mouse, human, rat
western blot pricing
WH0002550M1 Monoclonal Anti-GABBR1 antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
G013 R(+)-Baclofen hydrochloride solid human, mouse, rat pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C0987 CGP-13501 ≥98% (HPLC), solid human pricing
C0862 CGP-7930 >98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU210661 MISSION® esiRNA esiRNA targeting mouse Gabbr1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001470 Rosetta Predictions human pricing
NM_021903 Rosetta Predictions human pricing
NM_021904 Rosetta Predictions human pricing
NM_021905 Rosetta Predictions human pricing
NM_031028 Rosetta Predictions rat pricing
NM_019439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010863 predicted 2632
2 SASI_Hs02_00331919 predicted 1434
3 SASI_Hs01_00010864 predicted 2568
4 SASI_Hs02_00331920 predicted 1652
5 SASI_Hs02_00331921 predicted 1405
6 SASI_Hs02_00331922 predicted 1525
7 SASI_Hs02_00331923 predicted 1629
8 SASI_Hs02_00331924 predicted 1599
9 SASI_Hs02_00331925 predicted 1152
10 SASI_Hs02_00331926 predicted 1339
11 SASI_Hs01_00010861 predicted 941
12 SASI_Hs01_00010862 predicted 942
13 SASI_Hs01_00010865 predicted 2449
14 SASI_Hs01_00010866 predicted 2618
15 SASI_Hs01_00010867 predicted 3576
16 SASI_Hs01_00010868 predicted 2474
17 SASI_Hs01_00010869 predicted 2799
18 SASI_Hs01_00010870 predicted 3587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039677 predicted 2379
2 SASI_Hs02_00355155 predicted 1188
3 SASI_Hs01_00039678 predicted 2326
4 SASI_Hs02_00355156 predicted 1396
5 SASI_Hs02_00355157 predicted 1156
6 SASI_Hs02_00355158 predicted 1266
7 SASI_Hs02_00355159 predicted 1378
8 SASI_Hs02_00355160 predicted 1354
9 SASI_Hs02_00355161 predicted 904
10 SASI_Hs02_00355162 predicted 1088
11 SASI_Hs01_00039675 predicted 537
12 SASI_Hs01_00039676 predicted 542
13 SASI_Hs01_00039679 predicted 2033
14 SASI_Hs01_00039680 predicted 2220
15 SASI_Hs01_00039681 predicted 3174
16 SASI_Hs01_00039682 predicted 2074
17 SASI_Hs01_00039683 predicted 2393
18 SASI_Hs01_00039684 predicted 3181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170691 predicted 2444
2 SASI_Hs02_00355163 predicted 1252
3 SASI_Hs01_00170692 predicted 2389
4 SASI_Hs02_00355164 predicted 1469
5 SASI_Hs02_00355165 predicted 1222
6 SASI_Hs02_00355166 predicted 1337
7 SASI_Hs02_00355167 predicted 1444
8 SASI_Hs02_00355168 predicted 1416
9 SASI_Hs02_00355169 predicted 963
10 SASI_Hs02_00355170 predicted 1155
11 SASI_Hs01_00170689 predicted 763
12 SASI_Hs01_00170690 predicted 761
13 SASI_Hs01_00170693 predicted 2263
14 SASI_Hs01_00170694 predicted 2433
15 SASI_Hs01_00170695 predicted 3393
16 SASI_Hs01_00170696 predicted 2287
17 SASI_Hs01_00170697 predicted 2613
18 SASI_Hs01_00170698 predicted 3401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355171 predicted 2481
2 SASI_Hs02_00355172 predicted 1435
3 SASI_Hs01_00125288 predicted 2418
4 SASI_Hs02_00355173 predicted 1653
5 SASI_Hs02_00355174 predicted 1408
6 SASI_Hs02_00355175 predicted 1525
7 SASI_Hs02_00355176 predicted 1623
8 SASI_Hs02_00355177 predicted 1601
9 SASI_Hs02_00355178 predicted 1146
10 SASI_Hs02_00355179 predicted 1332
11 SASI_Hs01_00125286 predicted 948
12 SASI_Hs01_00125287 predicted 2362
13 SASI_Hs01_00125289 predicted 2281
14 SASI_Hs01_00125290 predicted 2467
15 SASI_Hs01_00125291 predicted 2434
16 SASI_Hs01_00125292 predicted 2294
17 SASI_Hs01_00125293 predicted 2240
18 SASI_Hs01_00125294 predicted 1003
19 SASI_Hs01_00125295 predicted 2473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121455 predicted 845
2 SASI_Rn01_00121457 predicted 2474
3 SASI_Rn01_00121458 predicted 461
4 SASI_Rn01_00121459 predicted 2525
5 SASI_Rn01_00121460 predicted 1846
6 SASI_Rn01_00121461 predicted 1508
7 SASI_Rn01_00121462 predicted 3024
8 SASI_Rn01_00121463 predicted 784
9 SASI_Rn02_00264229 predicted 1245
10 SASI_Rn02_00264230 predicted 975
11 SASI_Rn01_00121456 predicted 3037
12 SASI_Rn01_00121464 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142142 predicted 1522
2 SASI_Mm01_00142143 predicted 1992
3 SASI_Mm02_00324396 predicted 1300
4 SASI_Mm01_00142144 predicted 1469
5 SASI_Mm01_00142145 predicted 1539
6 SASI_Mm01_00142146 predicted 2055
7 SASI_Mm02_00324397 predicted 2612
8 SASI_Mm01_00142148 predicted 924
9 SASI_Mm02_00324398 predicted 1831
10 SASI_Mm02_00324399 predicted 1637
11 SASI_Mm01_00142139 predicted 3087
12 SASI_Mm01_00142140 predicted 2522
13 SASI_Mm01_00142141 predicted 2566
14 SASI_Mm01_00142147 predicted 3071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001470
GABBR1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) B receptor, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001470.1-4159s1c1
Sequence:CCGGCCCTCAGTCTACACTCACAATCTCGAGATTGTGAGTGTAGACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-942s1c1
Sequence:CCGGCCCTATCAAGATCATCCTTATCTCGAGATAAGGATGATCTTGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-1740s1c1
Sequence:CCGGCCAGACCATTACCGACCAAATCTCGAGATTTGGTCGGTAATGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-1121s1c1
Sequence:CCGGCCCGCGTGAAACTCTTTGAAACTCGAGTTTCAAAGAGTTTCACGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-2580s1c1
Sequence:CCGGGCTGGGAATCTTCCTTGCTTACTCGAGTAAGCAAGGAAGATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-2181s21c1
Sequence:CCGGCAACTCACATGTCCGTTATATCTCGAGATATAACGGACATGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-1006s21c1
Sequence:CCGGCAAGCCACCAAGTACCTATATCTCGAGATATAGGTACTTGGTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-1932s21c1
Sequence:CCGGTCGGATGGCATGGACGCTTATCTCGAGATAAGCGTCCATGCCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001470
GABBR1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) B receptor, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001470.1-4159s1c1
Sequence:CCGGCCCTCAGTCTACACTCACAATCTCGAGATTGTGAGTGTAGACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-942s1c1
Sequence:CCGGCCCTATCAAGATCATCCTTATCTCGAGATAAGGATGATCTTGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-1740s1c1
Sequence:CCGGCCAGACCATTACCGACCAAATCTCGAGATTTGGTCGGTAATGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-1121s1c1
Sequence:CCGGCCCGCGTGAAACTCTTTGAAACTCGAGTTTCAAAGAGTTTCACGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-2580s1c1
Sequence:CCGGGCTGGGAATCTTCCTTGCTTACTCGAGTAAGCAAGGAAGATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-2181s21c1
Sequence:CCGGCAACTCACATGTCCGTTATATCTCGAGATATAACGGACATGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-1006s21c1
Sequence:CCGGCAAGCCACCAAGTACCTATATCTCGAGATATAGGTACTTGGTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-1932s21c1
Sequence:CCGGTCGGATGGCATGGACGCTTATCTCGAGATAAGCGTCCATGCCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001470
GABBR1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) B receptor, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001470.1-4159s1c1
Sequence:CCGGCCCTCAGTCTACACTCACAATCTCGAGATTGTGAGTGTAGACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-942s1c1
Sequence:CCGGCCCTATCAAGATCATCCTTATCTCGAGATAAGGATGATCTTGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-1740s1c1
Sequence:CCGGCCAGACCATTACCGACCAAATCTCGAGATTTGGTCGGTAATGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-1121s1c1
Sequence:CCGGCCCGCGTGAAACTCTTTGAAACTCGAGTTTCAAAGAGTTTCACGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001470.1-2580s1c1
Sequence:CCGGGCTGGGAATCTTCCTTGCTTACTCGAGTAAGCAAGGAAGATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-2181s21c1
Sequence:CCGGCAACTCACATGTCCGTTATATCTCGAGATATAACGGACATGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-1006s21c1
Sequence:CCGGCAAGCCACCAAGTACCTATATCTCGAGATATAGGTACTTGGTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001470.2-1932s21c1
Sequence:CCGGTCGGATGGCATGGACGCTTATCTCGAGATAAGCGTCCATGCCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019439
VALIDATED
GABBR1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) B receptor, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019439.2-1237s1c1
Sequence:CCGGCGACAGAGTTTCTTCTCAGATCTCGAGATCTGAGAAGAAACTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019439.2-3499s1c1
Sequence:CCGGCCTCAGAATCTCCTTCCATTACTCGAGTAATGGAAGGAGATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019439.2-2421s1c1
Sequence:CCGGGCACCGAACCATTGAGACTTTCTCGAGAAAGTCTCAATGGTTCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019439.2-1363s1c1
Sequence:CCGGCGGCTCTTTGGGAAGAAGTATCTCGAGATACTTCTTCCCAAAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019439.2-2565s1c1
Sequence:CCGGGCTGGGAATCTTTCTTGCTTACTCGAGTAAGCAAGAAAGATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1339s21c1
Sequence:CCGGCGACAGAGTTTCTTCTCAGATCTCGAGATCTGAGAAGAAACTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019439.3-3421s21c1
Sequence:CCGGTGAACCCTGCTTGGAGCTATTCTCGAGAATAGCTCCAAGCAGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-400s21c1
Sequence:CCGGTCGGAAGGTTGCCAGATTATACTCGAGTATAATCTGGCAACCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1465s21c1
Sequence:CCGGCGGCTCTTTGGGAAGAAGTATCTCGAGATACTTCTTCCCAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1091s21c1
Sequence:CCGGCCCGGATGTGGAACCTTATTGCTCGAGCAATAAGGTTCCACATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019439
VALIDATED
GABBR1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) B receptor, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019439.2-1237s1c1
Sequence:CCGGCGACAGAGTTTCTTCTCAGATCTCGAGATCTGAGAAGAAACTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019439.2-3499s1c1
Sequence:CCGGCCTCAGAATCTCCTTCCATTACTCGAGTAATGGAAGGAGATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019439.2-2421s1c1
Sequence:CCGGGCACCGAACCATTGAGACTTTCTCGAGAAAGTCTCAATGGTTCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019439.2-1363s1c1
Sequence:CCGGCGGCTCTTTGGGAAGAAGTATCTCGAGATACTTCTTCCCAAAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019439.2-2565s1c1
Sequence:CCGGGCTGGGAATCTTTCTTGCTTACTCGAGTAAGCAAGAAAGATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1339s21c1
Sequence:CCGGCGACAGAGTTTCTTCTCAGATCTCGAGATCTGAGAAGAAACTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019439.3-3421s21c1
Sequence:CCGGTGAACCCTGCTTGGAGCTATTCTCGAGAATAGCTCCAAGCAGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-400s21c1
Sequence:CCGGTCGGAAGGTTGCCAGATTATACTCGAGTATAATCTGGCAACCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1465s21c1
Sequence:CCGGCGGCTCTTTGGGAAGAAGTATCTCGAGATACTTCTTCCCAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1091s21c1
Sequence:CCGGCCCGGATGTGGAACCTTATTGCTCGAGCAATAAGGTTCCACATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019439
VALIDATED
GABBR1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) B receptor, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019439.2-1237s1c1
Sequence:CCGGCGACAGAGTTTCTTCTCAGATCTCGAGATCTGAGAAGAAACTCTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019439.2-3499s1c1
Sequence:CCGGCCTCAGAATCTCCTTCCATTACTCGAGTAATGGAAGGAGATTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019439.2-2421s1c1
Sequence:CCGGGCACCGAACCATTGAGACTTTCTCGAGAAAGTCTCAATGGTTCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019439.2-1363s1c1
Sequence:CCGGCGGCTCTTTGGGAAGAAGTATCTCGAGATACTTCTTCCCAAAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019439.2-2565s1c1
Sequence:CCGGGCTGGGAATCTTTCTTGCTTACTCGAGTAAGCAAGAAAGATTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1339s21c1
Sequence:CCGGCGACAGAGTTTCTTCTCAGATCTCGAGATCTGAGAAGAAACTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019439.3-3421s21c1
Sequence:CCGGTGAACCCTGCTTGGAGCTATTCTCGAGAATAGCTCCAAGCAGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-400s21c1
Sequence:CCGGTCGGAAGGTTGCCAGATTATACTCGAGTATAATCTGGCAACCTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1465s21c1
Sequence:CCGGCGGCTCTTTGGGAAGAAGTATCTCGAGATACTTCTTCCCAAAGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019439.3-1091s21c1
Sequence:CCGGCCCGGATGTGGAACCTTATTGCTCGAGCAATAAGGTTCCACATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks