EMAIL THIS PAGE TO A FRIEND

GABBR2

gamma-aminobutyric acid (GABA) B receptor, 2

277 Gene Product Result for
Synonyms: GABABR2 GPR51 GPRC3B HG20 HRIHFB2099
Gene ID:
Human(9568) Summary: The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
Mouse(242425) gamma-aminobutyric acid (GABA) B receptor, 2
Rat(83633) gamma-aminobutyric acid (GABA) B receptor 2
Zebrafish(560267) gamma-aminobutyric acid (GABA) B receptor, 2
dog(481627) gamma-aminobutyric acid (GABA) B receptor, 2
Horse(100063963) gamma-aminobutyric acid (GABA) B receptor, 2
cow(517040) gamma-aminobutyric acid (GABA) B receptor, 2
domestic cat(101093058) gamma-aminobutyric acid (GABA) B receptor, 2
chicken(420979) gamma-aminobutyric acid (GABA) B receptor, 2
domestic guinea pig(100170764) gamma-aminobutyric acid (GABA) B receptor, 2
naked mole-rat(101719923) gamma-aminobutyric acid (GABA) B receptor, 2
sheep(101103544) gamma-aminobutyric acid (GABA) B receptor, 2
Domestic Rabbit(100346845) gamma-aminobutyric acid (GABA) B receptor, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G9920 Anti-GABAB Receptor 2 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
western blot pricing
HPA013820 Anti-GABBR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2700898 Anti-GABBR2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA031684 Anti-GABBR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5200411 Monoclonal Anti-Gaba-B Receptor 2 - Alkaline Phosphatase antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200412 Monoclonal Anti-Gaba-B Receptor 2 - Apc antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200403 Monoclonal Anti-Gaba-B Receptor 2 - Atto 390 antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200404 Monoclonal Anti-Gaba-B Receptor 2 - Atto 488 antibody produced in mouse clone S81-2, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200405 Monoclonal Anti-Gaba-B Receptor 2 - Atto 565 antibody produced in mouse clone S81-2, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200406 Monoclonal Anti-Gaba-B Receptor 2 - Atto 594 antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200407 Monoclonal Anti-Gaba-B Receptor 2 - Atto 633 antibody produced in mouse clone S81-2, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200408 Monoclonal Anti-Gaba-B Receptor 2 - Atto 655 antibody produced in mouse clone S81-2, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200409 Monoclonal Anti-Gaba-B Receptor 2 - Atto 680 antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200410 Monoclonal Anti-Gaba-B Receptor 2 - Atto 700 antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200413 Monoclonal Anti-Gaba-B Receptor 2 - Biotin antibody produced in mouse clone S81-2, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200414 Monoclonal Anti-Gaba-B Receptor 2 - Fitc antibody produced in mouse clone S81-2, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200415 Monoclonal Anti-Gaba-B Receptor 2 - Hrp antibody produced in mouse clone S81-2, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200416 Monoclonal Anti-Gaba-B Receptor 2 - Pe/Atto 594 antibody produced in mouse clone S81-2, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200417 Monoclonal Anti-Gaba-B Receptor 2 - Percp antibody produced in mouse clone S81-2, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200418 Monoclonal Anti-Gaba-B Receptor 2 - Rpe antibody produced in mouse clone S81-2, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200419 Monoclonal Anti-Gaba-B Receptor 2 - Streptavidin antibody produced in mouse clone S81-2, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200402 Monoclonal Anti-Gaba-B Receptor 2 antibody produced in mouse clone S81-2, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
B5399 (±)-Baclofen ≥98% (TLC), solid human, rat pricing
A2129 γ-Aminobutyric acid ≥99% human, rat pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
C0987 CGP-13501 ≥98% (HPLC), solid human pricing
C0862 CGP-7930 >98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A6566 2-Hydroxysaclofen ≥98% (TLC), solid human pricing
P118 Phaclofen solid human pricing
S166 Saclofen solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002331 MISSION® esiRNA esiRNA targeting human GABBR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005458 Rosetta Predictions human pricing
NM_031802 Rosetta Predictions rat pricing
NM_001081141 Rosetta Predictions mouse pricing
XM_143750 Rosetta Predictions mouse pricing
XM_988351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218972 predicted 2433
2 SASI_Hs01_00218973 predicted 1387
3 SASI_Hs02_00339618 predicted 2503
4 SASI_Hs01_00218974 predicted 1084
5 SASI_Hs01_00218975 predicted 1289
6 SASI_Hs02_00339619 predicted 1997
7 SASI_Hs01_00218976 predicted 1146
8 SASI_Hs01_00218977 predicted 2124
9 SASI_Hs01_00218978 predicted 1118
10 SASI_Hs01_00218979 predicted 1270
11 SASI_Hs01_00218980 predicted 1464
12 SASI_Hs01_00218981 predicted 2429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107051 predicted 2606
2 SASI_Rn01_00107052 predicted 1406
3 SASI_Rn01_00107053 predicted 2359
4 SASI_Rn01_00107054 predicted 2152
5 SASI_Rn01_00107055 predicted 1155
6 SASI_Rn01_00107056 predicted 1408
7 SASI_Rn01_00107057 predicted 2449
8 SASI_Rn01_00107058 predicted 2407
9 SASI_Rn01_00107059 predicted 1083
10 SASI_Rn02_00265249 predicted 1161
11 SASI_Rn01_00107060 predicted 2671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295581 predicted 1554
2 SASI_Mm02_00295582 predicted 617
3 SASI_Mm02_00295583 predicted 2491
4 SASI_Mm02_00295584 predicted 2540
5 SASI_Mm02_00295585 predicted 2348
6 SASI_Mm02_00295586 predicted 1097
7 SASI_Mm02_00295587 predicted 2276
8 SASI_Mm02_00295588 predicted 2461
9 SASI_Mm02_00295589 predicted 944
10 SASI_Mm02_00295590 predicted 3087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258128 predicted 1553
2 SASI_Mm01_00258129 predicted 1640
3 SASI_Mm01_00258130 predicted 623
4 SASI_Mm01_00258131 predicted 2499
5 SASI_Mm01_00258132 predicted 2547
6 SASI_Mm01_00258133 predicted 2352
7 SASI_Mm01_00258134 predicted 1095
8 SASI_Mm01_00258135 predicted 2286
9 SASI_Mm01_00258136 predicted 955
10 SASI_Mm01_00258137 predicted 3087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244903 predicted 1755
2 SASI_Mm01_00244904 predicted 1756
3 SASI_Mm01_00244905 predicted 1051
4 SASI_Mm01_00244906 predicted 1047
5 SASI_Mm01_00244907 predicted 835
6 SASI_Mm01_00244908 predicted 851
7 SASI_Mm01_00244909 predicted 773
8 SASI_Mm01_00244910 predicted 1683
9 SASI_Mm01_00244911 predicted 747
10 SASI_Mm01_00244912 predicted 1874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005458
GABBR2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) B receptor, 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-964s21c1
Sequence:CCGGGAGAACATGTATGGTAGTAAACTCGAGTTTACTACCATACATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-634s21c1
Sequence:CCGGACGCCTGTTCTAGCCGATAAGCTCGAGCTTATCGGCTAGAACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-563s21c1
Sequence:CCGGCATCCGTCACATCCATCATTGCTCGAGCAATGATGGATGTGACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-2395s1c1
Sequence:CCGGGCACTGTGAGAACACCCATATCTCGAGATATGGGTGTTCTCACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-830s1c1
Sequence:CCGGCCGAACCACTTGATGGTGTTTCTCGAGAAACACCATCAAGTGGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-1975s1c1
Sequence:CCGGCCGGAATCAGAAGCTCATAAACTCGAGTTTATGAGCTTCTGATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-986s1c1
Sequence:CCGGCCATCAGACAATGCGGTGAATCTCGAGATTCACCGCATTGTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005458.5-3470s1c1
Sequence:CCGGGCCTTATTTGTGAAGTCCTTACTCGAGTAAGGACTTCACAAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005458
GABBR2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) B receptor, 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-964s21c1
Sequence:CCGGGAGAACATGTATGGTAGTAAACTCGAGTTTACTACCATACATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-634s21c1
Sequence:CCGGACGCCTGTTCTAGCCGATAAGCTCGAGCTTATCGGCTAGAACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-563s21c1
Sequence:CCGGCATCCGTCACATCCATCATTGCTCGAGCAATGATGGATGTGACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-2395s1c1
Sequence:CCGGGCACTGTGAGAACACCCATATCTCGAGATATGGGTGTTCTCACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-830s1c1
Sequence:CCGGCCGAACCACTTGATGGTGTTTCTCGAGAAACACCATCAAGTGGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-1975s1c1
Sequence:CCGGCCGGAATCAGAAGCTCATAAACTCGAGTTTATGAGCTTCTGATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-986s1c1
Sequence:CCGGCCATCAGACAATGCGGTGAATCTCGAGATTCACCGCATTGTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005458.5-3470s1c1
Sequence:CCGGGCCTTATTTGTGAAGTCCTTACTCGAGTAAGGACTTCACAAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005458
GABBR2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) B receptor, 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-964s21c1
Sequence:CCGGGAGAACATGTATGGTAGTAAACTCGAGTTTACTACCATACATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-634s21c1
Sequence:CCGGACGCCTGTTCTAGCCGATAAGCTCGAGCTTATCGGCTAGAACAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005458.6-563s21c1
Sequence:CCGGCATCCGTCACATCCATCATTGCTCGAGCAATGATGGATGTGACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-2395s1c1
Sequence:CCGGGCACTGTGAGAACACCCATATCTCGAGATATGGGTGTTCTCACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-830s1c1
Sequence:CCGGCCGAACCACTTGATGGTGTTTCTCGAGAAACACCATCAAGTGGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-1975s1c1
Sequence:CCGGCCGGAATCAGAAGCTCATAAACTCGAGTTTATGAGCTTCTGATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005458.5-986s1c1
Sequence:CCGGCCATCAGACAATGCGGTGAATCTCGAGATTCACCGCATTGTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005458.5-3470s1c1
Sequence:CCGGGCCTTATTTGTGAAGTCCTTACTCGAGTAAGGACTTCACAAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081141
GABBR2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) B receptor, 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3378s21c1
Sequence:CCGGCAAATCAAACTCTAGACAAAGCTCGAGCTTTGTCTAGAGTTTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3274s21c1
Sequence:CCGGCCTTATCTACGACGGTCTTACCTCGAGGTAAGACCGTCGTAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3717s21c1
Sequence:CCGGATGCCACACATTAACACAATACTCGAGTATTGTGTTAATGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3348s21c1
Sequence:CCGGAGGAGTTGGGATGTCAGAAACCTCGAGGTTTCTGACATCCCAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081141
GABBR2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) B receptor, 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3378s21c1
Sequence:CCGGCAAATCAAACTCTAGACAAAGCTCGAGCTTTGTCTAGAGTTTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3274s21c1
Sequence:CCGGCCTTATCTACGACGGTCTTACCTCGAGGTAAGACCGTCGTAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3717s21c1
Sequence:CCGGATGCCACACATTAACACAATACTCGAGTATTGTGTTAATGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3348s21c1
Sequence:CCGGAGGAGTTGGGATGTCAGAAACCTCGAGGTTTCTGACATCCCAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081141
GABBR2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) B receptor, 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3378s21c1
Sequence:CCGGCAAATCAAACTCTAGACAAAGCTCGAGCTTTGTCTAGAGTTTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3274s21c1
Sequence:CCGGCCTTATCTACGACGGTCTTACCTCGAGGTAAGACCGTCGTAGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3717s21c1
Sequence:CCGGATGCCACACATTAACACAATACTCGAGTATTGTGTTAATGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081141.1-3348s21c1
Sequence:CCGGAGGAGTTGGGATGTCAGAAACCTCGAGGTTTCTGACATCCCAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks