EMAIL THIS PAGE TO A FRIEND

GABPA

GA binding protein transcription factor, alpha subunit 60kDa

130 Gene Product Result for
Synonyms: E4TF1-60 E4TF1A NFT2 NRF2 NRF2A RCH04A07
UniProtKB ID: Q06546, Q12939
Gene ID:
Human(2551) Summary: This gene encodes one of three GA-binding protein transcription factor subunits which functions as a DNA-binding subunit. Since this subunit shares identity with a subunit encoding the nuclear respiratory factor 2 gene, it is likely involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. This subunit also shares identity with a subunit constituting the transcription factor E4TF1, responsible for expression of the adenovirus E4 gene. Because of its chromosomal localization and ability to form heterodimers with other polypeptides, this gene may play a role in the Down Syndrome phenotype. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(14390) GA repeat binding protein, alpha
Rat(363735) GA binding protein transcription factor, alpha subunit
sheep(443478) GA binding protein transcription factor, alpha subunit 60kDa
naked mole-rat(101722967) GA binding protein transcription factor, alpha subunit 60kDa
domestic guinea pig(100715584) GA binding protein transcription factor, alpha subunit 60kDa
Zebrafish(58110) GA-binding protein transcription factor, alpha subunit
chicken(418478) GA binding protein transcription factor, alpha subunit 60kDa
dog(478394) GA binding protein transcription factor, alpha subunit 60kDa
cow(510204) GA binding protein transcription factor, alpha subunit 60kDa
Horse(100053853) GA binding protein transcription factor, alpha subunit 60kDa
domestic cat(101100659) GA binding protein transcription factor, alpha subunit 60kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003258 Anti-GABPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV100832 Anti-GABPA antibody produced in rabbit IgG fraction of antiserum rat, zebrafish, human, horse, mouse, bovine, canine
immunohistochemistry, western blot pricing
HPA028791 Anti-GABPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410470 Anti-GABPA antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0002551M4 Monoclonal Anti-GABPA antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403848 Monoclonal Anti-GABPA antibody produced in mouse clone 4B8-G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409061 Monoclonal Anti-GABPA antibody produced in mouse clone 5B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409062 Monoclonal Anti-GABPA antibody produced in mouse clone 5C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002040 Rosetta Predictions human pricing
NM_001108841 Rosetta Predictions rat pricing
NM_008065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088969 predicted 1209
2 SASI_Hs01_00088970 predicted 1789
3 SASI_Hs01_00088971 predicted 1538
4 SASI_Hs01_00088972 predicted 1288
5 SASI_Hs01_00088973 predicted 1575
6 SASI_Hs01_00088974 predicted 1681
7 SASI_Hs01_00088975 predicted 1521
8 SASI_Hs02_00333071 predicted 1596
9 SASI_Hs01_00088978 predicted 1195
10 SASI_Hs02_00333072 predicted 1428
11 SASI_Hs01_00088976 predicted 1639
12 SASI_Hs01_00088977 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242605 predicted 1259
2 SASI_Rn02_00242606 predicted 883
3 SASI_Rn02_00242607 predicted 1546
4 SASI_Rn02_00242608 predicted 1533
5 SASI_Rn02_00242609 predicted 1032
6 SASI_Rn02_00242610 predicted 1461
7 SASI_Rn02_00242611 predicted 1470
8 SASI_Rn02_00242612 predicted 545
9 SASI_Rn02_00242613 predicted 702
10 SASI_Rn02_00242614 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030953 predicted 1613
2 SASI_Mm01_00030954 predicted 640
3 SASI_Mm01_00030955 predicted 1569
4 SASI_Mm01_00030956 predicted 1561
5 SASI_Mm01_00030957 predicted 1046
6 SASI_Mm01_00030958 predicted 586
7 SASI_Mm01_00030959 predicted 863
8 SASI_Mm01_00030960 predicted 722
9 SASI_Mm01_00030962 predicted 1155
10 SASI_Mm02_00313051 predicted 1532
11 SASI_Mm01_00030961 predicted 1662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002040
VALIDATED
GABPA MISSION shRNA Bacterial Glycerol Stock
GA binding protein transcription factor, alpha subunit 60kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002040.2-2473s1c1
Sequence:CCGGGCAGCTTATATTCCTTTGTTTCTCGAGAAACAAAGGAATATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-578s1c1
Sequence:CCGGGAGGTTGTTATTGATCCAGATCTCGAGATCTGGATCAATAACAACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-1020s1c1
Sequence:CCGGCTGTGCAAATTATTCCAGCATCTCGAGATGCTGGAATAATTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002040.2-1195s1c1
Sequence:CCGGGCTAGAACTTCTTACTGATAACTCGAGTTATCAGTAAGAAGTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-1116s1c1
Sequence:CCGGCGAGGATTTCAGGAGAAGATACTCGAGTATCTTCTCCTGAAATCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002040.3-865s21c1
Sequence:CCGGAGCTTAGTGTACAGGTAATTTCTCGAGAAATTACCTGTACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002040.3-721s21c1
Sequence:CCGGATGAACCAATAGGCAATTTAACTCGAGTTAAATTGCCTATTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002040.3-4197s21c1
Sequence:CCGGCATAGGTAATGTGACTAATTTCTCGAGAAATTAGTCACATTACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002040
VALIDATED
GABPA MISSION shRNA shRNA Plasmid DNA
GA binding protein transcription factor, alpha subunit 60kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002040.2-2473s1c1
Sequence:CCGGGCAGCTTATATTCCTTTGTTTCTCGAGAAACAAAGGAATATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-578s1c1
Sequence:CCGGGAGGTTGTTATTGATCCAGATCTCGAGATCTGGATCAATAACAACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-1020s1c1
Sequence:CCGGCTGTGCAAATTATTCCAGCATCTCGAGATGCTGGAATAATTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002040.2-1195s1c1
Sequence:CCGGGCTAGAACTTCTTACTGATAACTCGAGTTATCAGTAAGAAGTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-1116s1c1
Sequence:CCGGCGAGGATTTCAGGAGAAGATACTCGAGTATCTTCTCCTGAAATCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002040.3-865s21c1
Sequence:CCGGAGCTTAGTGTACAGGTAATTTCTCGAGAAATTACCTGTACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002040.3-721s21c1
Sequence:CCGGATGAACCAATAGGCAATTTAACTCGAGTTAAATTGCCTATTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002040.3-4197s21c1
Sequence:CCGGCATAGGTAATGTGACTAATTTCTCGAGAAATTAGTCACATTACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002040
VALIDATED
GABPA MISSION shRNA Lentiviral Transduction Particles
GA binding protein transcription factor, alpha subunit 60kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002040.2-2473s1c1
Sequence:CCGGGCAGCTTATATTCCTTTGTTTCTCGAGAAACAAAGGAATATAAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-578s1c1
Sequence:CCGGGAGGTTGTTATTGATCCAGATCTCGAGATCTGGATCAATAACAACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-1020s1c1
Sequence:CCGGCTGTGCAAATTATTCCAGCATCTCGAGATGCTGGAATAATTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_002040.2-1195s1c1
Sequence:CCGGGCTAGAACTTCTTACTGATAACTCGAGTTATCAGTAAGAAGTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002040.2-1116s1c1
Sequence:CCGGCGAGGATTTCAGGAGAAGATACTCGAGTATCTTCTCCTGAAATCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002040.3-865s21c1
Sequence:CCGGAGCTTAGTGTACAGGTAATTTCTCGAGAAATTACCTGTACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002040.3-721s21c1
Sequence:CCGGATGAACCAATAGGCAATTTAACTCGAGTTAAATTGCCTATTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002040.3-4197s21c1
Sequence:CCGGCATAGGTAATGTGACTAATTTCTCGAGAAATTAGTCACATTACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008065
VALIDATED
GABPA MISSION shRNA Bacterial Glycerol Stock
GA binding protein transcription factor, alpha subunit 60kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008065.2-3996s1c1
Sequence:CCGGCCTAAGATACAGTTGAACAAACTCGAGTTTGTTCAACTGTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1570s1c1
Sequence:CCGGGCCGTGCATTACGGTATTATTCTCGAGAATAATACCGTAATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-892s1c1
Sequence:CCGGCCAAGCACATTACGACCATTTCTCGAGAAATGGTCGTAATGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1452s1c1
Sequence:CCGGCGAGACTGTATTTCTTGGGTTCTCGAGAACCCAAGAAATACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1572s1c1
Sequence:CCGGCGTGCATTACGGTATTATTATCTCGAGATAATAATACCGTAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-1572s21c1
Sequence:CCGGCGTGCATTACGGTATTATTATCTCGAGATAATAATACCGTAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-1281s21c1
Sequence:CCGGGCTACACCGACTACGATTAAACTCGAGTTTAATCGTAGTCGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-2273s21c1
Sequence:CCGGAGCTAAGCAGTCCTATCAAATCTCGAGATTTGATAGGACTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-580s21c1
Sequence:CCGGATGAACCAATAGGCAATTTAACTCGAGTTAAATTGCCTATTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-724s21c1
Sequence:CCGGAGCTTAGTGTACAGGTAATTTCTCGAGAAATTACCTGTACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008065
VALIDATED
GABPA MISSION shRNA shRNA Plasmid DNA
GA binding protein transcription factor, alpha subunit 60kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008065.2-3996s1c1
Sequence:CCGGCCTAAGATACAGTTGAACAAACTCGAGTTTGTTCAACTGTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1570s1c1
Sequence:CCGGGCCGTGCATTACGGTATTATTCTCGAGAATAATACCGTAATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-892s1c1
Sequence:CCGGCCAAGCACATTACGACCATTTCTCGAGAAATGGTCGTAATGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1452s1c1
Sequence:CCGGCGAGACTGTATTTCTTGGGTTCTCGAGAACCCAAGAAATACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1572s1c1
Sequence:CCGGCGTGCATTACGGTATTATTATCTCGAGATAATAATACCGTAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-1572s21c1
Sequence:CCGGCGTGCATTACGGTATTATTATCTCGAGATAATAATACCGTAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-1281s21c1
Sequence:CCGGGCTACACCGACTACGATTAAACTCGAGTTTAATCGTAGTCGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-2273s21c1
Sequence:CCGGAGCTAAGCAGTCCTATCAAATCTCGAGATTTGATAGGACTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-580s21c1
Sequence:CCGGATGAACCAATAGGCAATTTAACTCGAGTTAAATTGCCTATTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-724s21c1
Sequence:CCGGAGCTTAGTGTACAGGTAATTTCTCGAGAAATTACCTGTACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008065
VALIDATED
GABPA MISSION shRNA Lentiviral Transduction Particles
GA binding protein transcription factor, alpha subunit 60kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008065.2-3996s1c1
Sequence:CCGGCCTAAGATACAGTTGAACAAACTCGAGTTTGTTCAACTGTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1570s1c1
Sequence:CCGGGCCGTGCATTACGGTATTATTCTCGAGAATAATACCGTAATGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-892s1c1
Sequence:CCGGCCAAGCACATTACGACCATTTCTCGAGAAATGGTCGTAATGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1452s1c1
Sequence:CCGGCGAGACTGTATTTCTTGGGTTCTCGAGAACCCAAGAAATACAGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008065.2-1572s1c1
Sequence:CCGGCGTGCATTACGGTATTATTATCTCGAGATAATAATACCGTAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-1572s21c1
Sequence:CCGGCGTGCATTACGGTATTATTATCTCGAGATAATAATACCGTAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-1281s21c1
Sequence:CCGGGCTACACCGACTACGATTAAACTCGAGTTTAATCGTAGTCGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-2273s21c1
Sequence:CCGGAGCTAAGCAGTCCTATCAAATCTCGAGATTTGATAGGACTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-580s21c1
Sequence:CCGGATGAACCAATAGGCAATTTAACTCGAGTTAAATTGCCTATTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008065.2-724s21c1
Sequence:CCGGAGCTTAGTGTACAGGTAATTTCTCGAGAAATTACCTGTACACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks