EMAIL THIS PAGE TO A FRIEND

GABPB1

GA binding protein transcription factor, beta subunit 1

120 Gene Product Result for
Synonyms: BABPB2 E4TF1 E4TF1-47 E4TF1-53 E4TF1B GABPB GABPB2 NRF2B1 NRF2B2
Gene ID:
Human(2553) Summary: This gene encodes the GA-binding protein transcription factor, beta subunit. This protein forms a tetrameric complex with the alpha subunit, and stimulates transcription of target genes. The encoded protein may be involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. The crystal structure of a similar protein in mouse has been resolved as a ternary protein complex. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14391) GA repeat binding protein, beta 1
Rat(499883) GA binding protein transcription factor, beta subunit 1
domestic guinea pig(100715707) GA binding protein transcription factor, beta subunit 1
naked mole-rat(101711074) GA binding protein transcription factor, beta subunit 1
Zebrafish(768285) GA binding protein transcription factor, beta subunit 1
chicken(415453) GA binding protein transcription factor, beta subunit 1
domestic cat(101096070) GA binding protein transcription factor, beta subunit 1
Horse(100055527) GA binding protein transcription factor, beta subunit 1
cow(520313) GA binding protein transcription factor, beta subunit 1
dog(608465) GA binding protein transcription factor, beta subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019653 Anti-GABPB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
HPA067444 Anti-GABPB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1412672 ANTI-GABPB1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2500440 Anti-GABPB2 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human
ELISA, western blot pricing
SAB1405838 Anti-GABPB2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV100833 Anti-GABPB2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, zebrafish, rat, rabbit, canine, horse, human
immunohistochemistry, western blot pricing
AV100925 Anti-GABPB2 antibody produced in rabbit affinity isolated antibody canine, mouse, horse, human, guinea pig, rat, bovine
immunohistochemistry, western blot pricing
SAB2100875 Anti-GABPB2 antibody produced in rabbit affinity isolated antibody bovine, zebrafish, rat, canine, mouse, guinea pig, horse, rabbit, human
western blot pricing
SAB2104182 Anti-GABPB2 antibody produced in rabbit affinity isolated antibody , zebrafish, rabbit, rat, guinea pig, bovine, horse, canine, human, mouse
western blot pricing
SAB2103228 Anti-GABPB2, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, rabbit, mouse, guinea pig, bovine, canine, zebrafish, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002041 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002041 Rosetta Predictions human pricing
NM_005254 Rosetta Predictions human pricing
NM_016654 Rosetta Predictions human pricing
NM_016655 Rosetta Predictions human pricing
NM_181427 Rosetta Predictions human pricing
NM_001039036 Rosetta Predictions rat pricing
NM_010249 Rosetta Predictions mouse pricing
NM_207669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102551 predicted 410
2 SASI_Hs01_00102552 predicted 420
3 SASI_Hs01_00102553 predicted 421
4 SASI_Hs01_00102554 predicted 497
5 SASI_Hs02_00333073 predicted 562
6 SASI_Hs02_00333074 predicted 558
7 SASI_Hs01_00102557 predicted 415
8 SASI_Hs01_00102558 predicted 414
9 SASI_Hs01_00102559 predicted 538
10 SASI_Hs02_00333075 predicted 498
11 SASI_Hs01_00102550 predicted 510
12 SASI_Hs01_00102555 predicted 466
13 SASI_Hs01_00102556 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110038 predicted 416
2 SASI_Hs01_00110039 predicted 417
3 SASI_Hs01_00110040 predicted 422
4 SASI_Hs01_00110042 predicted 495
5 SASI_Hs02_00339279 predicted 561
6 SASI_Hs02_00339280 predicted 553
7 SASI_Hs01_00110045 predicted 419
8 SASI_Hs01_00110046 predicted 413
9 SASI_Hs01_00110047 predicted 542
10 SASI_Hs02_00339281 predicted 498
11 SASI_Hs01_00110041 predicted 549
12 SASI_Hs01_00110043 predicted 461
13 SASI_Hs01_00110044 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206683 predicted 414
2 SASI_Hs01_00206684 predicted 419
3 SASI_Hs01_00206685 predicted 421
4 SASI_Hs01_00206686 predicted 497
5 SASI_Hs02_00349840 predicted 556
6 SASI_Hs02_00349841 predicted 552
7 SASI_Hs01_00206689 predicted 417
8 SASI_Hs01_00206690 predicted 415
9 SASI_Hs01_00206691 predicted 536
10 SASI_Hs02_00349842 predicted 501
11 SASI_Hs01_00206682 predicted 510
12 SASI_Hs01_00206687 predicted 465
13 SASI_Hs01_00206688 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128579 predicted 413
2 SASI_Hs01_00128580 predicted 423
3 SASI_Hs01_00128581 predicted 418
4 SASI_Hs01_00128582 predicted 501
5 SASI_Hs02_00349843 predicted 562
6 SASI_Hs02_00349844 predicted 556
7 SASI_Hs01_00128585 predicted 416
8 SASI_Hs01_00128586 predicted 418
9 SASI_Hs01_00128587 predicted 540
10 SASI_Hs02_00349845 predicted 500
11 SASI_Hs01_00128578 predicted 506
12 SASI_Hs01_00128583 predicted 469
13 SASI_Hs01_00128584 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222082 predicted 438
2 SASI_Hs01_00222083 predicted 443
3 SASI_Hs01_00222084 predicted 441
4 SASI_Hs01_00222086 predicted 520
5 SASI_Hs02_00370046 predicted 584
6 SASI_Hs02_00370047 predicted 581
7 SASI_Hs01_00222089 predicted 440
8 SASI_Hs01_00222090 predicted 445
9 SASI_Hs01_00222091 predicted 562
10 SASI_Hs02_00370048 predicted 526
11 SASI_Hs01_00222085 predicted 570
12 SASI_Hs01_00222087 predicted 486
13 SASI_Hs01_00222088 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032420 predicted 514
2 SASI_Rn01_00032421 predicted 441
3 SASI_Rn01_00032422 predicted 439
4 SASI_Rn01_00032423 predicted 738
5 SASI_Rn01_00032424 predicted 526
6 SASI_Rn01_00032425 predicted 266
7 SASI_Rn01_00032426 predicted 327
8 SASI_Rn01_00032427 predicted 738
9 SASI_Rn01_00032428 predicted 788
10 SASI_Rn01_00032429 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098590 predicted 597
2 SASI_Mm01_00098591 predicted 237
3 SASI_Mm01_00098592 predicted 499
4 SASI_Mm01_00098593 predicted 569
5 SASI_Mm01_00098594 predicted 448
6 SASI_Mm01_00098595 predicted 417
7 SASI_Mm01_00098596 predicted 452
8 SASI_Mm01_00098597 predicted 377
9 SASI_Mm01_00098598 predicted 510
10 SASI_Mm02_00318138 predicted 603
11 SASI_Mm01_00098599 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095561 predicted 594
2 SASI_Mm01_00095562 predicted 235
3 SASI_Mm01_00095563 predicted 496
4 SASI_Mm01_00095564 predicted 566
5 SASI_Mm01_00095565 predicted 451
6 SASI_Mm01_00095566 predicted 420
7 SASI_Mm01_00095567 predicted 448
8 SASI_Mm01_00095568 predicted 374
9 SASI_Mm01_00095569 predicted 508
10 SASI_Mm02_00352198 predicted 602
11 SASI_Mm01_00095570 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002041
VALIDATED
GABPB1 MISSION shRNA Bacterial Glycerol Stock
GA binding protein transcription factor, beta subunit 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1089s21c1
Sequence:CCGGGAATTGGTCAGCCCATCATTGCTCGAGCAATGATGGGCTGACCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1197s21c1
Sequence:CCGGAGAGACAATGTATCGAAATAACTCGAGTTATTTCGATACATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002041.3-266s21c1
Sequence:CCGGCAAGATGATGAAGTTCGTATTCTCGAGAATACGAACTTCATCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1158s21c1
Sequence:CCGGTTGCTGAAGAAACTGTTATAACTCGAGTTATAACAGTTTCTTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002041.3-1118s21c1
Sequence:CCGGCCAGATGGACAACAAGTATTACTCGAGTAATACTTGTTGTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002041.2-649s1c1
Sequence:CCGGGCAGAACCAAATCAACACAAACTCGAGTTTGTGTTGATTTGGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-500s1c1
Sequence:CCGGGCCACAGAACACAATCATCAACTCGAGTTGATGATTGTGTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-1012s1c1
Sequence:CCGGGCTTGGAAATTTGCACTCTATCTCGAGATAGAGTGCAAATTTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-1073s1c1
Sequence:CCGGCCAGATGGACAACAAGTATTACTCGAGTAATACTTGTTGTCCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-782s1c1
Sequence:CCGGGCAACAGATGAAACGGGTGTACTCGAGTACACCCGTTTCATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002041
VALIDATED
GABPB1 MISSION shRNA shRNA Plasmid DNA
GA binding protein transcription factor, beta subunit 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1089s21c1
Sequence:CCGGGAATTGGTCAGCCCATCATTGCTCGAGCAATGATGGGCTGACCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1197s21c1
Sequence:CCGGAGAGACAATGTATCGAAATAACTCGAGTTATTTCGATACATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002041.3-266s21c1
Sequence:CCGGCAAGATGATGAAGTTCGTATTCTCGAGAATACGAACTTCATCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1158s21c1
Sequence:CCGGTTGCTGAAGAAACTGTTATAACTCGAGTTATAACAGTTTCTTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002041.3-1118s21c1
Sequence:CCGGCCAGATGGACAACAAGTATTACTCGAGTAATACTTGTTGTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002041.2-649s1c1
Sequence:CCGGGCAGAACCAAATCAACACAAACTCGAGTTTGTGTTGATTTGGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-500s1c1
Sequence:CCGGGCCACAGAACACAATCATCAACTCGAGTTGATGATTGTGTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-1012s1c1
Sequence:CCGGGCTTGGAAATTTGCACTCTATCTCGAGATAGAGTGCAAATTTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-1073s1c1
Sequence:CCGGCCAGATGGACAACAAGTATTACTCGAGTAATACTTGTTGTCCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-782s1c1
Sequence:CCGGGCAACAGATGAAACGGGTGTACTCGAGTACACCCGTTTCATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002041
VALIDATED
GABPB1 MISSION shRNA Lentiviral Transduction Particles
GA binding protein transcription factor, beta subunit 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1089s21c1
Sequence:CCGGGAATTGGTCAGCCCATCATTGCTCGAGCAATGATGGGCTGACCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1197s21c1
Sequence:CCGGAGAGACAATGTATCGAAATAACTCGAGTTATTTCGATACATTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002041.3-266s21c1
Sequence:CCGGCAAGATGATGAAGTTCGTATTCTCGAGAATACGAACTTCATCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002041.3-1158s21c1
Sequence:CCGGTTGCTGAAGAAACTGTTATAACTCGAGTTATAACAGTTTCTTCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_002041.3-1118s21c1
Sequence:CCGGCCAGATGGACAACAAGTATTACTCGAGTAATACTTGTTGTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002041.2-649s1c1
Sequence:CCGGGCAGAACCAAATCAACACAAACTCGAGTTTGTGTTGATTTGGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-500s1c1
Sequence:CCGGGCCACAGAACACAATCATCAACTCGAGTTGATGATTGTGTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-1012s1c1
Sequence:CCGGGCTTGGAAATTTGCACTCTATCTCGAGATAGAGTGCAAATTTCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-1073s1c1
Sequence:CCGGCCAGATGGACAACAAGTATTACTCGAGTAATACTTGTTGTCCATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002041.2-782s1c1
Sequence:CCGGGCAACAGATGAAACGGGTGTACTCGAGTACACCCGTTTCATCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010249
VALIDATED
GABPB1 MISSION shRNA Bacterial Glycerol Stock
GA binding protein transcription factor, beta subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-456s21c1
Sequence:GTACCGGCATTGGGCAACAGAACATAATCTCGAGATTATGTTCTGTTGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-602s21c1
Sequence:GTACCGGGATTGCTATGCAGAACCAAATCTCGAGATTTGGTTCTGCATAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010249.1-999s21c1
Sequence:CCGGCCCGATGGACAGCAAGTATTGCTCGAGCAATACTTGCTGTCCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-905s21c1
Sequence:CCGGGCAAGTCATCACGATAGTTACCTCGAGGTAACTATCGTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-872s21c1
Sequence:CCGGTGCAATTCAGCAAGTAGTTAGCTCGAGCTAACTACTTGCTGAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-1107s1c1
Sequence:CCGGCGGGTGGAATGTGCAGAAATTCTCGAGAATTTCTGCACATTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-1106s1c1
Sequence:CCGGCCGGGTGGAATGTGCAGAAATCTCGAGATTTCTGCACATTCCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-462s1c1
Sequence:CCGGGCAACAGAACATAATCATCAACTCGAGTTGATGATTATGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010249.1-378s1c1
Sequence:CCGGCATGCCAACATAGTAGAAGTTCTCGAGAACTTCTACTATGTTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010249.1-1029s1c1
Sequence:CCGGGCAACAGACATTGCTGAAGAACTCGAGTTCTTCAGCAATGTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010249
VALIDATED
GABPB1 MISSION shRNA shRNA Plasmid DNA
GA binding protein transcription factor, beta subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-456s21c1
Sequence:GTACCGGCATTGGGCAACAGAACATAATCTCGAGATTATGTTCTGTTGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-602s21c1
Sequence:GTACCGGGATTGCTATGCAGAACCAAATCTCGAGATTTGGTTCTGCATAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010249.1-999s21c1
Sequence:CCGGCCCGATGGACAGCAAGTATTGCTCGAGCAATACTTGCTGTCCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-905s21c1
Sequence:CCGGGCAAGTCATCACGATAGTTACCTCGAGGTAACTATCGTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-872s21c1
Sequence:CCGGTGCAATTCAGCAAGTAGTTAGCTCGAGCTAACTACTTGCTGAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-1107s1c1
Sequence:CCGGCGGGTGGAATGTGCAGAAATTCTCGAGAATTTCTGCACATTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-1106s1c1
Sequence:CCGGCCGGGTGGAATGTGCAGAAATCTCGAGATTTCTGCACATTCCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-462s1c1
Sequence:CCGGGCAACAGAACATAATCATCAACTCGAGTTGATGATTATGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010249.1-378s1c1
Sequence:CCGGCATGCCAACATAGTAGAAGTTCTCGAGAACTTCTACTATGTTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010249.1-1029s1c1
Sequence:CCGGGCAACAGACATTGCTGAAGAACTCGAGTTCTTCAGCAATGTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010249
VALIDATED
GABPB1 MISSION shRNA Lentiviral Transduction Particles
GA binding protein transcription factor, beta subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-456s21c1
Sequence:GTACCGGCATTGGGCAACAGAACATAATCTCGAGATTATGTTCTGTTGCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-602s21c1
Sequence:GTACCGGGATTGCTATGCAGAACCAAATCTCGAGATTTGGTTCTGCATAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010249.1-999s21c1
Sequence:CCGGCCCGATGGACAGCAAGTATTGCTCGAGCAATACTTGCTGTCCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-905s21c1
Sequence:CCGGGCAAGTCATCACGATAGTTACCTCGAGGTAACTATCGTGATGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010249.1-872s21c1
Sequence:CCGGTGCAATTCAGCAAGTAGTTAGCTCGAGCTAACTACTTGCTGAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-1107s1c1
Sequence:CCGGCGGGTGGAATGTGCAGAAATTCTCGAGAATTTCTGCACATTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-1106s1c1
Sequence:CCGGCCGGGTGGAATGTGCAGAAATCTCGAGATTTCTGCACATTCCACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010249.1-462s1c1
Sequence:CCGGGCAACAGAACATAATCATCAACTCGAGTTGATGATTATGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010249.1-378s1c1
Sequence:CCGGCATGCCAACATAGTAGAAGTTCTCGAGAACTTCTACTATGTTGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010249.1-1029s1c1
Sequence:CCGGGCAACAGACATTGCTGAAGAACTCGAGTTCTTCAGCAATGTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks