EMAIL THIS PAGE TO A FRIEND

GABPB2

GA binding protein transcription factor, beta subunit 2

198 Gene Product Result for
UniProtKB ID: Q8TAK5, B1AVJ8, D3DV14, Q8NAR5
Gene ID:
Mouse(213054) GA repeat binding protein, beta 2
Rat(295263) GA binding protein transcription factor, beta subunit 2
domestic guinea pig(100723876) GA binding protein transcription factor, beta subunit 2
naked mole-rat(101708800) GA binding protein transcription factor, beta subunit 2
sheep(101111329) GA binding protein transcription factor, beta subunit 2
dog(475841) GA binding protein transcription factor, beta subunit 2
Horse(100055303) GA binding protein transcription factor, beta subunit 2
cow(540818) GA binding protein transcription factor, beta subunit 2
domestic cat(101096502) GA binding protein transcription factor, beta subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144618 Rosetta Predictions human pricing
XM_001055557 Rosetta Predictions rat pricing
XM_001055604 Rosetta Predictions rat pricing
XM_227439 Rosetta Predictions rat pricing
NM_029885 Rosetta Predictions mouse pricing
NM_172512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177339 predicted 1695
2 SASI_Hs01_00177340 predicted 1283
3 SASI_Hs01_00177341 predicted 1310
4 SASI_Hs01_00177342 predicted 1382
5 SASI_Hs01_00177343 predicted 1167
6 SASI_Hs02_00364440 predicted 1482
7 SASI_Hs02_00364441 predicted 349
8 SASI_Hs01_00177345 predicted 896
9 SASI_Hs01_00177346 predicted 747
10 SASI_Hs01_00177347 predicted 1080
11 SASI_Hs01_00177344 predicted 1218
12 SASI_Hs01_00177348 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280014 predicted 683
2 SASI_Rn02_00280015 predicted 701
3 SASI_Rn02_00280016 predicted 672
4 SASI_Rn02_00280017 predicted 689
5 SASI_Rn02_00280018 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280271 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384401 predicted 960
2 SASI_Rn02_00384402 predicted 689
3 SASI_Rn02_00384403 predicted 241
4 SASI_Rn02_00384404 predicted 344
5 SASI_Rn02_00384405 predicted 854
6 SASI_Rn02_00384406 predicted 568
7 SASI_Rn02_00384407 predicted 259
8 SASI_Rn02_00384408 predicted 1011
9 SASI_Rn02_00384409 predicted 409
10 SASI_Rn02_00384410 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336117 predicted 1160
2 SASI_Mm02_00336118 predicted 776
3 SASI_Mm02_00336119 predicted 1311
4 SASI_Mm02_00336120 predicted 1448
5 SASI_Mm02_00336121 predicted 1649
6 SASI_Mm02_00336122 predicted 1861
7 SASI_Mm02_00336123 predicted 1819
8 SASI_Mm02_00336124 predicted 1742
9 SASI_Mm02_00336125 predicted 1009
10 SASI_Mm02_00336126 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089666 predicted 1063
2 SASI_Mm01_00089667 predicted 681
3 SASI_Mm02_00344108 predicted 1215
4 SASI_Mm01_00089668 predicted 1350
5 SASI_Mm01_00089669 predicted 1554
6 SASI_Mm01_00089671 predicted 1759
7 SASI_Mm02_00344109 predicted 1713
8 SASI_Mm01_00089672 predicted 1645
9 SASI_Mm01_00089673 predicted 915
10 SASI_Mm01_00089674 predicted 718
11 SASI_Mm01_00089670 predicted 248
12 SASI_Mm01_00089675 predicted 1137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144618
VALIDATED
GABPB2 MISSION shRNA Bacterial Glycerol Stock
GA binding protein transcription factor, beta subunit 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144618.1-806s1c1
Sequence:CCGGGCAATGCAGAATCAGGTGAATCTCGAGATTCACCTGATTCTGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144618.1-2079s1c1
Sequence:CCGGCCTTAGATTTATGATGCGTATCTCGAGATACGCATCATAAATCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144618.1-1516s1c1
Sequence:CCGGGCAGCCCAATGGAGTTGATTTCTCGAGAAATCAACTCCATTGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144618.1-1639s1c1
Sequence:CCGGGCCTCACACTAGAGTTTCCATCTCGAGATGGAAACTCTAGTGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144618.1-381s1c1
Sequence:CCGGGCCAAGATGATGAAGTGAGAACTCGAGTTCTCACTTCATCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-678s21c1
Sequence:CCGGATCGAGATGTCGTAGAGTTACCTCGAGGTAACTCTACGACATCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-906s21c1
Sequence:CCGGTTAACCTCGCAAGCCTTATTTCTCGAGAAATAAGGCTTGCGAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144618.2-1694s21c1
Sequence:CCGGATTTGCACTGTGTTCATATTACTCGAGTAATATGAACACAGTGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144618.2-1679s21c1
Sequence:CCGGTATGCAAGGGCCACAATTTGCCTCGAGGCAAATTGTGGCCCTTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-1313s21c1
Sequence:CCGGGAGAAGTTGCCACTAACAAAGCTCGAGCTTTGTTAGTGGCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144618
VALIDATED
GABPB2 MISSION shRNA shRNA Plasmid DNA
GA binding protein transcription factor, beta subunit 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144618.1-806s1c1
Sequence:CCGGGCAATGCAGAATCAGGTGAATCTCGAGATTCACCTGATTCTGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144618.1-2079s1c1
Sequence:CCGGCCTTAGATTTATGATGCGTATCTCGAGATACGCATCATAAATCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144618.1-1516s1c1
Sequence:CCGGGCAGCCCAATGGAGTTGATTTCTCGAGAAATCAACTCCATTGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144618.1-1639s1c1
Sequence:CCGGGCCTCACACTAGAGTTTCCATCTCGAGATGGAAACTCTAGTGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144618.1-381s1c1
Sequence:CCGGGCCAAGATGATGAAGTGAGAACTCGAGTTCTCACTTCATCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-678s21c1
Sequence:CCGGATCGAGATGTCGTAGAGTTACCTCGAGGTAACTCTACGACATCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-906s21c1
Sequence:CCGGTTAACCTCGCAAGCCTTATTTCTCGAGAAATAAGGCTTGCGAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144618.2-1694s21c1
Sequence:CCGGATTTGCACTGTGTTCATATTACTCGAGTAATATGAACACAGTGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144618.2-1679s21c1
Sequence:CCGGTATGCAAGGGCCACAATTTGCCTCGAGGCAAATTGTGGCCCTTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-1313s21c1
Sequence:CCGGGAGAAGTTGCCACTAACAAAGCTCGAGCTTTGTTAGTGGCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144618
VALIDATED
GABPB2 MISSION shRNA Lentiviral Transduction Particles
GA binding protein transcription factor, beta subunit 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144618.1-806s1c1
Sequence:CCGGGCAATGCAGAATCAGGTGAATCTCGAGATTCACCTGATTCTGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144618.1-2079s1c1
Sequence:CCGGCCTTAGATTTATGATGCGTATCTCGAGATACGCATCATAAATCTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144618.1-1516s1c1
Sequence:CCGGGCAGCCCAATGGAGTTGATTTCTCGAGAAATCAACTCCATTGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144618.1-1639s1c1
Sequence:CCGGGCCTCACACTAGAGTTTCCATCTCGAGATGGAAACTCTAGTGTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144618.1-381s1c1
Sequence:CCGGGCCAAGATGATGAAGTGAGAACTCGAGTTCTCACTTCATCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-678s21c1
Sequence:CCGGATCGAGATGTCGTAGAGTTACCTCGAGGTAACTCTACGACATCTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-906s21c1
Sequence:CCGGTTAACCTCGCAAGCCTTATTTCTCGAGAAATAAGGCTTGCGAGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144618.2-1694s21c1
Sequence:CCGGATTTGCACTGTGTTCATATTACTCGAGTAATATGAACACAGTGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144618.2-1679s21c1
Sequence:CCGGTATGCAAGGGCCACAATTTGCCTCGAGGCAAATTGTGGCCCTTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144618.2-1313s21c1
Sequence:CCGGGAGAAGTTGCCACTAACAAAGCTCGAGCTTTGTTAGTGGCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172512
VALIDATED
GABPB2 MISSION shRNA Bacterial Glycerol Stock
GA binding protein transcription factor, beta subunit 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172512.1-1913s1c1
Sequence:CCGGGCACACAAGTTCTCCCTAGTTCTCGAGAACTAGGGAGAACTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172512.1-1417s1c1
Sequence:CCGGCCTCACACTAACGTTTCCATACTCGAGTATGGAAACGTTAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172512.1-567s1c1
Sequence:CCGGCGTCGAGTTACTTATCAAATACTCGAGTATTTGATAAGTAACTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172512.1-827s1c1
Sequence:CCGGCCTCAGCTCATTTAGAAGAAACTCGAGTTTCTTCTAAATGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172512.1-980s1c1
Sequence:CCGGGCCAGCCATTTATTGTAACTACTCGAGTAGTTACAATAAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-696s21c1
Sequence:CCGGCATCGTGGAACTGCTTGTTAGCTCGAGCTAACAAGCAGTTCCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1272s21c1
Sequence:CCGGGGTTGCAGAGGAGACAATAATCTCGAGATTATTGTCTCCTCTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1536s21c1
Sequence:CCGGAGTTGATGTCACCGTAGTTGACTCGAGTCAACTACGGTGACATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1356s21c1
Sequence:CCGGGACAAACAGGGTTGAGGAAATCTCGAGATTTCCTCAACCCTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1161s21c1
Sequence:CCGGTGGAGTCCCTCTGGGTAACATCTCGAGATGTTACCCAGAGGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172512.2-1701s21c1
Sequence:CCGGACTTGTGCTCACTCATCATATCTCGAGATATGATGAGTGAGCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172512
VALIDATED
GABPB2 MISSION shRNA shRNA Plasmid DNA
GA binding protein transcription factor, beta subunit 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172512.1-1913s1c1
Sequence:CCGGGCACACAAGTTCTCCCTAGTTCTCGAGAACTAGGGAGAACTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172512.1-1417s1c1
Sequence:CCGGCCTCACACTAACGTTTCCATACTCGAGTATGGAAACGTTAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172512.1-567s1c1
Sequence:CCGGCGTCGAGTTACTTATCAAATACTCGAGTATTTGATAAGTAACTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172512.1-827s1c1
Sequence:CCGGCCTCAGCTCATTTAGAAGAAACTCGAGTTTCTTCTAAATGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172512.1-980s1c1
Sequence:CCGGGCCAGCCATTTATTGTAACTACTCGAGTAGTTACAATAAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-696s21c1
Sequence:CCGGCATCGTGGAACTGCTTGTTAGCTCGAGCTAACAAGCAGTTCCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1272s21c1
Sequence:CCGGGGTTGCAGAGGAGACAATAATCTCGAGATTATTGTCTCCTCTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1536s21c1
Sequence:CCGGAGTTGATGTCACCGTAGTTGACTCGAGTCAACTACGGTGACATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1356s21c1
Sequence:CCGGGACAAACAGGGTTGAGGAAATCTCGAGATTTCCTCAACCCTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1161s21c1
Sequence:CCGGTGGAGTCCCTCTGGGTAACATCTCGAGATGTTACCCAGAGGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172512.2-1701s21c1
Sequence:CCGGACTTGTGCTCACTCATCATATCTCGAGATATGATGAGTGAGCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172512
VALIDATED
GABPB2 MISSION shRNA Lentiviral Transduction Particles
GA binding protein transcription factor, beta subunit 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172512.1-1913s1c1
Sequence:CCGGGCACACAAGTTCTCCCTAGTTCTCGAGAACTAGGGAGAACTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172512.1-1417s1c1
Sequence:CCGGCCTCACACTAACGTTTCCATACTCGAGTATGGAAACGTTAGTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172512.1-567s1c1
Sequence:CCGGCGTCGAGTTACTTATCAAATACTCGAGTATTTGATAAGTAACTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172512.1-827s1c1
Sequence:CCGGCCTCAGCTCATTTAGAAGAAACTCGAGTTTCTTCTAAATGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172512.1-980s1c1
Sequence:CCGGGCCAGCCATTTATTGTAACTACTCGAGTAGTTACAATAAATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-696s21c1
Sequence:CCGGCATCGTGGAACTGCTTGTTAGCTCGAGCTAACAAGCAGTTCCACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1272s21c1
Sequence:CCGGGGTTGCAGAGGAGACAATAATCTCGAGATTATTGTCTCCTCTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1536s21c1
Sequence:CCGGAGTTGATGTCACCGTAGTTGACTCGAGTCAACTACGGTGACATCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1356s21c1
Sequence:CCGGGACAAACAGGGTTGAGGAAATCTCGAGATTTCCTCAACCCTGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172512.2-1161s21c1
Sequence:CCGGTGGAGTCCCTCTGGGTAACATCTCGAGATGTTACCCAGAGGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172512.2-1701s21c1
Sequence:CCGGACTTGTGCTCACTCATCATATCTCGAGATATGATGAGTGAGCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks