EMAIL THIS PAGE TO A FRIEND

GABRA2

gamma-aminobutyric acid (GABA) A receptor, alpha 2

140 Gene Product Result for
UniProtKB ID: P47869, Q59G14
Gene ID:
Human(2555) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14395) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 2
Rat(289606) gamma-aminobutyric acid (GABA) A receptor, alpha 2
domestic guinea pig(100720796) gamma-aminobutyric acid (GABA) A receptor, alpha 2
naked mole-rat(101720776) gamma-aminobutyric acid (GABA) A receptor, alpha 2
sheep(101121265) gamma-aminobutyric acid (GABA) A receptor, alpha 2
Domestic Rabbit(100339376) gamma-aminobutyric acid (GABA) A receptor, alpha 2
chicken(770511) gamma-aminobutyric acid (GABA) A receptor, alpha 2
domestic cat(100286789) gamma-aminobutyric acid (GABA) A receptor, alpha 2
cow(282236) gamma-aminobutyric acid (GABA) A receptor, alpha 2
Horse(100061914) gamma-aminobutyric acid (GABA) A receptor, alpha 2
dog(482131) gamma-aminobutyric acid (GABA) A receptor, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014261 Anti-GABRA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV13026 Anti-GABRA2 antibody produced in rabbit IgG fraction of antiserum canine, rat, horse, mouse, rabbit, bovine, human
western blot pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000807 Rosetta Predictions human pricing
NM_001114175 Rosetta Predictions human pricing
XM_223378 Rosetta Predictions rat pricing
XR_009140 Rosetta Predictions rat pricing
NM_008066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303267 predicted 553
2 SASI_Hs01_00058931 predicted 1756
3 SASI_Hs01_00058932 predicted 906
4 SASI_Hs02_00303268 predicted 896
5 SASI_Hs01_00058933 predicted 629
6 SASI_Hs02_00303269 predicted 1251
7 SASI_Hs02_00303270 predicted 1114
8 SASI_Hs01_00058934 predicted 1142
9 SASI_Hs01_00058936 predicted 884
10 SASI_Hs01_00058938 predicted 1198
11 SASI_Hs01_00058935 predicted 1079
12 SASI_Hs01_00058937 predicted 397
13 SASI_Hs01_00058939 predicted 708
14 SASI_Hs01_00058940 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326434 predicted 906
2 SASI_Hs02_00326435 predicted 2115
3 SASI_Hs02_00326436 predicted 1265
4 SASI_Hs02_00326437 predicted 1251
5 SASI_Hs02_00326438 predicted 985
6 SASI_Hs02_00326439 predicted 1615
7 SASI_Hs02_00326440 predicted 1471
8 SASI_Hs02_00326441 predicted 1500
9 SASI_Hs02_00326442 predicted 1240
10 SASI_Hs02_00326443 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381305 predicted 1817
2 SASI_Rn02_00381306 predicted 1138
3 SASI_Rn02_00381307 predicted 1070
4 SASI_Rn02_00381308 predicted 1803
5 SASI_Rn02_00381309 predicted 1764
6 SASI_Rn02_00381310 predicted 1796
7 SASI_Rn02_00381311 predicted 1710
8 SASI_Rn02_00381312 predicted 1082
9 SASI_Rn02_00381313 predicted 1070
10 SASI_Rn02_00381314 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00418873 predicted 846
2 SASI_Rn02_00418874 predicted 693
3 SASI_Rn02_00418875 predicted 492
4 SASI_Rn02_00418876 predicted 447
5 SASI_Rn02_00418877 predicted 362
6 SASI_Rn02_00418878 predicted 515
7 SASI_Rn02_00418879 predicted 284
8 SASI_Rn02_00418880 predicted 1015
9 SASI_Rn02_00418881 predicted 978
10 SASI_Rn02_00418882 predicted 713
11 SASI_Rn01_00136979 predicted 1822
12 SASI_Rn01_00136980 predicted 1137
13 SASI_Rn01_00136981 predicted 1077
14 SASI_Rn01_00136982 predicted 1809
15 SASI_Rn01_00136983 predicted 1767
16 SASI_Rn01_00136984 predicted 1803
17 SASI_Rn01_00136985 predicted 1183
18 SASI_Rn01_00136986 predicted 1715
19 SASI_Rn01_00136987 predicted 1083
20 SASI_Rn01_00136988 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071373 predicted 523
2 SASI_Mm01_00071374 predicted 944
3 SASI_Mm01_00071375 predicted 1231
4 SASI_Mm01_00071376 predicted 1350
5 SASI_Mm01_00071377 predicted 737
6 SASI_Mm01_00071378 predicted 957
7 SASI_Mm01_00071379 predicted 1669
8 SASI_Mm02_00313052 predicted 1723
9 SASI_Mm01_00071380 predicted 762
10 SASI_Mm01_00071381 predicted 692
11 SASI_Mm01_00071382 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008066
GABRA2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-775s1c1
Sequence:CCGGAGTCCAAGCCGAATGTCCCATCTCGAGATGGGACATTCGGCTTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1256s1c1
Sequence:CCGGGCGTTTGTGTTCTCTGCCCTACTCGAGTAGGGCAGAGAACACAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1433s1c1
Sequence:CCGGGATCCTGTCCTCTCTACCATTCTCGAGAATGGTAGAGAGGACAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1230s1c1
Sequence:CCGGTGGACTGGTTTATAGCTGTTTCTCGAGAAACAGCTATAAACCAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-1325s21c1
Sequence:CCGGACGGGAAGAGTGTAGTCAATGCTCGAGCATTGACTACACTCTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-488s21c1
Sequence:CCGGCTGAAGTCTTCACTAACATTTCTCGAGAAATGTTAGTGAAGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008066
GABRA2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-775s1c1
Sequence:CCGGAGTCCAAGCCGAATGTCCCATCTCGAGATGGGACATTCGGCTTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1256s1c1
Sequence:CCGGGCGTTTGTGTTCTCTGCCCTACTCGAGTAGGGCAGAGAACACAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1433s1c1
Sequence:CCGGGATCCTGTCCTCTCTACCATTCTCGAGAATGGTAGAGAGGACAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1230s1c1
Sequence:CCGGTGGACTGGTTTATAGCTGTTTCTCGAGAAACAGCTATAAACCAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-1325s21c1
Sequence:CCGGACGGGAAGAGTGTAGTCAATGCTCGAGCATTGACTACACTCTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-488s21c1
Sequence:CCGGCTGAAGTCTTCACTAACATTTCTCGAGAAATGTTAGTGAAGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008066
GABRA2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-775s1c1
Sequence:CCGGAGTCCAAGCCGAATGTCCCATCTCGAGATGGGACATTCGGCTTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1256s1c1
Sequence:CCGGGCGTTTGTGTTCTCTGCCCTACTCGAGTAGGGCAGAGAACACAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1433s1c1
Sequence:CCGGGATCCTGTCCTCTCTACCATTCTCGAGAATGGTAGAGAGGACAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008066.x-1230s1c1
Sequence:CCGGTGGACTGGTTTATAGCTGTTTCTCGAGAAACAGCTATAAACCAGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-1325s21c1
Sequence:CCGGACGGGAAGAGTGTAGTCAATGCTCGAGCATTGACTACACTCTTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008066.3-488s21c1
Sequence:CCGGCTGAAGTCTTCACTAACATTTCTCGAGAAATGTTAGTGAAGACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000807
GABRA2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000807.1-1578s1c1
Sequence:CCGGCCATGTTATCTTTGGGATGTACTCGAGTACATCCCAAAGATAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-1016s1c1
Sequence:CCGGCCCAAGTTTCATTCTGGCTTACTCGAGTAAGCCAGAATGAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-532s1c1
Sequence:CCGGCCTATGAATATCCTTCGACTACTCGAGTAGTCGAAGGATATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-636s1c1
Sequence:CCGGGCCAAATAAGTTGCTTCGAATCTCGAGATTCGAAGCAACTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-446s1c1
Sequence:CCGGGCCCTGTCTCAGATACAGATACTCGAGTATCTGTATCTGAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-1396s21c1
Sequence:GTACCGGATGATACAGAACAACGCTTATCTCGAGATAAGCGTTGTTCTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-603s21c1
Sequence:CCGGATGGAAAGATGAACGTTTAAACTCGAGTTTAAACGTTCATCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-636s21c1
Sequence:CCGGTATGAATATCCTTCGACTAAACTCGAGTTTAGTCGAAGGATATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000807.2-1729s21c1
Sequence:CCGGTATGTACAGTCTGACTAATAACTCGAGTTATTAGTCAGACTGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-943s21c1
Sequence:CCGGCCTGATGGCTCTAGGTTAAATCTCGAGATTTAACCTAGAGCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000807
GABRA2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000807.1-1578s1c1
Sequence:CCGGCCATGTTATCTTTGGGATGTACTCGAGTACATCCCAAAGATAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-1016s1c1
Sequence:CCGGCCCAAGTTTCATTCTGGCTTACTCGAGTAAGCCAGAATGAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-532s1c1
Sequence:CCGGCCTATGAATATCCTTCGACTACTCGAGTAGTCGAAGGATATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-636s1c1
Sequence:CCGGGCCAAATAAGTTGCTTCGAATCTCGAGATTCGAAGCAACTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-446s1c1
Sequence:CCGGGCCCTGTCTCAGATACAGATACTCGAGTATCTGTATCTGAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-1396s21c1
Sequence:GTACCGGATGATACAGAACAACGCTTATCTCGAGATAAGCGTTGTTCTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-603s21c1
Sequence:CCGGATGGAAAGATGAACGTTTAAACTCGAGTTTAAACGTTCATCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-636s21c1
Sequence:CCGGTATGAATATCCTTCGACTAAACTCGAGTTTAGTCGAAGGATATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000807.2-1729s21c1
Sequence:CCGGTATGTACAGTCTGACTAATAACTCGAGTTATTAGTCAGACTGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-943s21c1
Sequence:CCGGCCTGATGGCTCTAGGTTAAATCTCGAGATTTAACCTAGAGCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000807
GABRA2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061178    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000807.1-1578s1c1
Sequence:CCGGCCATGTTATCTTTGGGATGTACTCGAGTACATCCCAAAGATAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-1016s1c1
Sequence:CCGGCCCAAGTTTCATTCTGGCTTACTCGAGTAAGCCAGAATGAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-532s1c1
Sequence:CCGGCCTATGAATATCCTTCGACTACTCGAGTAGTCGAAGGATATTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-636s1c1
Sequence:CCGGGCCAAATAAGTTGCTTCGAATCTCGAGATTCGAAGCAACTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000807.1-446s1c1
Sequence:CCGGGCCCTGTCTCAGATACAGATACTCGAGTATCTGTATCTGAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-1396s21c1
Sequence:GTACCGGATGATACAGAACAACGCTTATCTCGAGATAAGCGTTGTTCTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-603s21c1
Sequence:CCGGATGGAAAGATGAACGTTTAAACTCGAGTTTAAACGTTCATCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-636s21c1
Sequence:CCGGTATGAATATCCTTCGACTAAACTCGAGTTTAGTCGAAGGATATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000807.2-1729s21c1
Sequence:CCGGTATGTACAGTCTGACTAATAACTCGAGTTATTAGTCAGACTGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000807.2-943s21c1
Sequence:CCGGCCTGATGGCTCTAGGTTAAATCTCGAGATTTAACCTAGAGCCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks