EMAIL THIS PAGE TO A FRIEND

GABRA3

gamma-aminobutyric acid (GABA) A receptor, alpha 3

83 Gene Product Result for
UniProtKB ID: P34903, Q8TAF9
Gene ID:
Human(2556) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
Mouse(14396) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 3
Rat(24947) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Zebrafish(100884145) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Zebrafish(100333913) gamma-aminobutyric acid (GABA) A receptor, alpha 3
cow(282237) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Horse(100063420) gamma-aminobutyric acid (GABA) A receptor, alpha 3
domestic cat(100294524) gamma-aminobutyric acid (GABA) A receptor, alpha 3
dog(492223) gamma-aminobutyric acid (GABA) A receptor, alpha 3
chicken(422289) gamma-aminobutyric acid (GABA) A receptor, alpha 3
sheep(101113565) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Domestic Rabbit(100349107) gamma-aminobutyric acid (GABA) A receptor, alpha 3
naked mole-rat(101714519) gamma-aminobutyric acid (GABA) A receptor, alpha 3
domestic guinea pig(100725783) gamma-aminobutyric acid (GABA) A receptor, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038321 MISSION® esiRNA esiRNA human GABRA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000808 Rosetta Predictions human pricing
NM_017069 Rosetta Predictions rat pricing
NM_008067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303271 predicted 1695
2 SASI_Hs01_00195413 predicted 401
3 SASI_Hs01_00195414 predicted 847
4 SASI_Hs01_00195415 predicted 1104
5 SASI_Hs01_00195417 predicted 1660
6 SASI_Hs01_00195418 predicted 744
7 SASI_Hs01_00195419 predicted 556
8 SASI_Hs02_00303272 predicted 1269
9 SASI_Hs01_00195420 predicted 1647
10 SASI_Hs01_00195421 predicted 855
11 SASI_Hs01_00195416 predicted 1209
12 SASI_Hs01_00195422 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088068 predicted 425
2 SASI_Rn01_00088069 predicted 399
3 SASI_Rn01_00088070 predicted 809
4 SASI_Rn01_00088071 predicted 1272
5 SASI_Rn01_00088072 predicted 410
6 SASI_Rn01_00088073 predicted 780
7 SASI_Rn01_00088074 predicted 865
8 SASI_Rn01_00088075 predicted 1009
9 SASI_Rn01_00088076 predicted 360
10 SASI_Rn01_00088077 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156977 predicted 528
2 SASI_Mm01_00156978 predicted 851
3 SASI_Mm01_00156979 predicted 1641
4 SASI_Mm01_00156980 predicted 385
5 SASI_Mm01_00156981 predicted 1074
6 SASI_Mm01_00156982 predicted 749
7 SASI_Mm01_00156983 predicted 1244
8 SASI_Mm01_00156984 predicted 838
9 SASI_Mm01_00156985 predicted 1398
10 SASI_Mm01_00156986 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000808
GABRA3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000808.3-562s21c1
Sequence:CCGGACTGACATGGAGTACACTATTCTCGAGAATAGTGTACTCCATGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000808.3-1903s21c1
Sequence:CCGGCTCCAATATTGCCCAGTATAACTCGAGTTATACTGGGCAATATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1079s1c1
Sequence:CCGGCCAGACCTACTTGCCATGTATCTCGAGATACATGGCAAGTAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-419s1c1
Sequence:CCGGCACTGACAACATCACTATCTTCTCGAGAAGATAGTGATGTTGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1266s1c1
Sequence:CCGGGCCGTCTGTTATGCCTTTGTACTCGAGTACAAAGGCATAACAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-854s1c1
Sequence:CCGGCCCACTGAAGTTTGGAAGCTACTCGAGTAGCTTCCAAACTTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1685s1c1
Sequence:CCGGGTCAGCTATCAAGGGCATGATCTCGAGATCATGCCCTTGATAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000808
GABRA3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000808.3-562s21c1
Sequence:CCGGACTGACATGGAGTACACTATTCTCGAGAATAGTGTACTCCATGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000808.3-1903s21c1
Sequence:CCGGCTCCAATATTGCCCAGTATAACTCGAGTTATACTGGGCAATATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1079s1c1
Sequence:CCGGCCAGACCTACTTGCCATGTATCTCGAGATACATGGCAAGTAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-419s1c1
Sequence:CCGGCACTGACAACATCACTATCTTCTCGAGAAGATAGTGATGTTGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1266s1c1
Sequence:CCGGGCCGTCTGTTATGCCTTTGTACTCGAGTACAAAGGCATAACAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-854s1c1
Sequence:CCGGCCCACTGAAGTTTGGAAGCTACTCGAGTAGCTTCCAAACTTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1685s1c1
Sequence:CCGGGTCAGCTATCAAGGGCATGATCTCGAGATCATGCCCTTGATAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000808
GABRA3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000808.3-562s21c1
Sequence:CCGGACTGACATGGAGTACACTATTCTCGAGAATAGTGTACTCCATGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000808.3-1903s21c1
Sequence:CCGGCTCCAATATTGCCCAGTATAACTCGAGTTATACTGGGCAATATTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1079s1c1
Sequence:CCGGCCAGACCTACTTGCCATGTATCTCGAGATACATGGCAAGTAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-419s1c1
Sequence:CCGGCACTGACAACATCACTATCTTCTCGAGAAGATAGTGATGTTGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1266s1c1
Sequence:CCGGGCCGTCTGTTATGCCTTTGTACTCGAGTACAAAGGCATAACAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-854s1c1
Sequence:CCGGCCCACTGAAGTTTGGAAGCTACTCGAGTAGCTTCCAAACTTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000808.2-1685s1c1
Sequence:CCGGGTCAGCTATCAAGGGCATGATCTCGAGATCATGCCCTTGATAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008067
GABRA3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-305s1c1
Sequence:CCGGGGGAATCAAGACGACAAGAACCTCGAGGTTCTTGTCGTCTTGATTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1202s1c1
Sequence:CCGGTACCTAAAGTGGCATACGCGACTCGAGTCGCGTATGCCACTTTAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-460s1c1
Sequence:CCGGCTTCGACCTGGACTTGGAGATCTCGAGATCTCCAAGTCCAGGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1397s1c1
Sequence:CCGGCCTTCAACATAGTGGGTACCACTCGAGTGGTACCCACTATGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1546s1c1
Sequence:CCGGGCTGAGACCAAGACCTACAACCTCGAGGTTGTAGGTCTTGGTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008067
GABRA3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-305s1c1
Sequence:CCGGGGGAATCAAGACGACAAGAACCTCGAGGTTCTTGTCGTCTTGATTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1202s1c1
Sequence:CCGGTACCTAAAGTGGCATACGCGACTCGAGTCGCGTATGCCACTTTAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-460s1c1
Sequence:CCGGCTTCGACCTGGACTTGGAGATCTCGAGATCTCCAAGTCCAGGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1397s1c1
Sequence:CCGGCCTTCAACATAGTGGGTACCACTCGAGTGGTACCCACTATGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1546s1c1
Sequence:CCGGGCTGAGACCAAGACCTACAACCTCGAGGTTGTAGGTCTTGGTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008067
GABRA3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-305s1c1
Sequence:CCGGGGGAATCAAGACGACAAGAACCTCGAGGTTCTTGTCGTCTTGATTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1202s1c1
Sequence:CCGGTACCTAAAGTGGCATACGCGACTCGAGTCGCGTATGCCACTTTAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-460s1c1
Sequence:CCGGCTTCGACCTGGACTTGGAGATCTCGAGATCTCCAAGTCCAGGTCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1397s1c1
Sequence:CCGGCCTTCAACATAGTGGGTACCACTCGAGTGGTACCCACTATGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008067.x-1546s1c1
Sequence:CCGGGCTGAGACCAAGACCTACAACCTCGAGGTTGTAGGTCTTGGTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks