EMAIL THIS PAGE TO A FRIEND

GABRA5

gamma-aminobutyric acid (GABA) A receptor, alpha 5

115 Gene Product Result for
Gene ID:
Human(2558) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Transcript variants utilizing three different alternative non-coding first exons have been described. [provided by RefSeq, Jul 2008]
Mouse(110886) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 5
Rat(29707) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Zebrafish(799124) gamma-aminobutyric acid (GABA) A receptor, alpha 5
dog(488688) gamma-aminobutyric acid (GABA) A receptor, alpha 5
cow(523515) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Horse(100050880) gamma-aminobutyric acid (GABA) A receptor, alpha 5
domestic cat(101090773) gamma-aminobutyric acid (GABA) A receptor, alpha 5
chicken(418684) gamma-aminobutyric acid (GABA) A receptor, alpha 5
sheep(101115159) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Domestic Rabbit(100340943) gamma-aminobutyric acid (GABA) A receptor, alpha 5
naked mole-rat(101712275) gamma-aminobutyric acid (GABA) A receptor, alpha 5
domestic guinea pig(100729411) gamma-aminobutyric acid (GABA) A receptor, alpha 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
L9787 L-655,708 ≥98% (HPLC), powder human pricing
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000810 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077241 MISSION® esiRNA esiRNA human GABRA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000810 Rosetta Predictions human pricing
NM_017295 Rosetta Predictions rat pricing
NM_176942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129486 predicted 1435
2 SASI_Hs01_00129487 predicted 1585
3 SASI_Hs01_00129488 predicted 644
4 SASI_Hs01_00129489 predicted 1145
5 SASI_Hs01_00129490 predicted 1563
6 SASI_Hs01_00129491 predicted 919
7 SASI_Hs01_00129492 predicted 910
8 SASI_Hs01_00129493 predicted 1155
9 SASI_Hs01_00129494 predicted 923
10 SASI_Hs01_00129495 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037030 predicted 298
2 SASI_Rn01_00037031 predicted 864
3 SASI_Rn01_00037032 predicted 558
4 SASI_Rn01_00037033 predicted 701
5 SASI_Rn01_00037034 predicted 1520
6 SASI_Rn02_00261733 predicted 1767
7 SASI_Rn01_00037035 predicted 417
8 SASI_Rn01_00037036 predicted 356
9 SASI_Rn01_00037037 predicted 1621
10 SASI_Rn01_00037038 predicted 730
11 SASI_Rn01_00037039 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096262 predicted 1440
2 SASI_Mm01_00096263 predicted 401
3 SASI_Mm01_00096264 predicted 1658
4 SASI_Mm01_00096265 predicted 361
5 SASI_Mm02_00346837 predicted 357
6 SASI_Mm01_00096266 predicted 464
7 SASI_Mm01_00096267 predicted 439
8 SASI_Mm02_00346838 predicted 444
9 SASI_Mm01_00096270 predicted 1669
10 SASI_Mm01_00096271 predicted 1265
11 SASI_Mm01_00096268 predicted 1365
12 SASI_Mm01_00096269 predicted 796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176942
GABRA5 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-1439s21c1
Sequence:CCGGAGAACGCGAACTCATACTAAACTCGAGTTTAGTATGAGTTCGCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-660s21c1
Sequence:CCGGGATGAAAGGCTGCGGTTTAAGCTCGAGCTTAAACCGCAGCCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-458s1c1
Sequence:CCGGGTACAAGACGAGACCAATGACCTCGAGGTCATTGGTCTCGTCTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-752s1c1
Sequence:CCGGCACAACGGCAAGAAGTCCATTCTCGAGAATGGACTTCTTGCCGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-832s1c1
Sequence:CCGGCTACACCATGCGTCTGACAATCTCGAGATTGTCAGACGCATGGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176942
GABRA5 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-1439s21c1
Sequence:CCGGAGAACGCGAACTCATACTAAACTCGAGTTTAGTATGAGTTCGCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-660s21c1
Sequence:CCGGGATGAAAGGCTGCGGTTTAAGCTCGAGCTTAAACCGCAGCCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-458s1c1
Sequence:CCGGGTACAAGACGAGACCAATGACCTCGAGGTCATTGGTCTCGTCTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-752s1c1
Sequence:CCGGCACAACGGCAAGAAGTCCATTCTCGAGAATGGACTTCTTGCCGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-832s1c1
Sequence:CCGGCTACACCATGCGTCTGACAATCTCGAGATTGTCAGACGCATGGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176942
GABRA5 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-1439s21c1
Sequence:CCGGAGAACGCGAACTCATACTAAACTCGAGTTTAGTATGAGTTCGCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176942.4-660s21c1
Sequence:CCGGGATGAAAGGCTGCGGTTTAAGCTCGAGCTTAAACCGCAGCCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-458s1c1
Sequence:CCGGGTACAAGACGAGACCAATGACCTCGAGGTCATTGGTCTCGTCTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-752s1c1
Sequence:CCGGCACAACGGCAAGAAGTCCATTCTCGAGAATGGACTTCTTGCCGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176942.x-832s1c1
Sequence:CCGGCTACACCATGCGTCTGACAATCTCGAGATTGTCAGACGCATGGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000810
VALIDATED
GABRA5 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-467s21c1
Sequence:CCGGATGACAACATCACGATATTTACTCGAGTAAATATCGTGATGTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1685s21c1
Sequence:CCGGTGAATAGGGAGCCGGTGATAACTCGAGTTATCACCGGCTCCCTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-2146s21c1
Sequence:CCGGGCGAGAAACAGAGATCATAAACTCGAGTTTATGATCTCTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1346s21c1
Sequence:CCGGTAGAGTTTGCCACGGTCAATTCTCGAGAATTGACCGTGGCAAACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000810.2-655s21c1
Sequence:CCGGGATGAAAGGCTTCGGTTTAAGCTCGAGCTTAAACCGAAGCCTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1650s1c1
Sequence:CCGGCGGCACTTTCAACTTAGTTTACTCGAGTAAACTAAGTTGAAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-477s1c1
Sequence:CCGGCACGATATTTACCAGGATCTTCTCGAGAAGATCCTGGTAAATATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-402s1c1
Sequence:CCGGCATGAACTTATCCAGTCACTTCTCGAGAAGTGACTGGATAAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1626s1c1
Sequence:CCGGCCGAATCGTATTCCCAGTCTTCTCGAGAAGACTGGGAATACGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1434s1c1
Sequence:CCGGGCGTGAAGTCATACTAAATAACTCGAGTTATTTAGTATGACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000810
VALIDATED
GABRA5 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-467s21c1
Sequence:CCGGATGACAACATCACGATATTTACTCGAGTAAATATCGTGATGTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1685s21c1
Sequence:CCGGTGAATAGGGAGCCGGTGATAACTCGAGTTATCACCGGCTCCCTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-2146s21c1
Sequence:CCGGGCGAGAAACAGAGATCATAAACTCGAGTTTATGATCTCTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1346s21c1
Sequence:CCGGTAGAGTTTGCCACGGTCAATTCTCGAGAATTGACCGTGGCAAACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000810.2-655s21c1
Sequence:CCGGGATGAAAGGCTTCGGTTTAAGCTCGAGCTTAAACCGAAGCCTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1650s1c1
Sequence:CCGGCGGCACTTTCAACTTAGTTTACTCGAGTAAACTAAGTTGAAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-477s1c1
Sequence:CCGGCACGATATTTACCAGGATCTTCTCGAGAAGATCCTGGTAAATATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-402s1c1
Sequence:CCGGCATGAACTTATCCAGTCACTTCTCGAGAAGTGACTGGATAAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1626s1c1
Sequence:CCGGCCGAATCGTATTCCCAGTCTTCTCGAGAAGACTGGGAATACGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1434s1c1
Sequence:CCGGGCGTGAAGTCATACTAAATAACTCGAGTTATTTAGTATGACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000810
VALIDATED
GABRA5 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-467s21c1
Sequence:CCGGATGACAACATCACGATATTTACTCGAGTAAATATCGTGATGTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1685s21c1
Sequence:CCGGTGAATAGGGAGCCGGTGATAACTCGAGTTATCACCGGCTCCCTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-2146s21c1
Sequence:CCGGGCGAGAAACAGAGATCATAAACTCGAGTTTATGATCTCTGTTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000810.2-1346s21c1
Sequence:CCGGTAGAGTTTGCCACGGTCAATTCTCGAGAATTGACCGTGGCAAACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000810.2-655s21c1
Sequence:CCGGGATGAAAGGCTTCGGTTTAAGCTCGAGCTTAAACCGAAGCCTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1650s1c1
Sequence:CCGGCGGCACTTTCAACTTAGTTTACTCGAGTAAACTAAGTTGAAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-477s1c1
Sequence:CCGGCACGATATTTACCAGGATCTTCTCGAGAAGATCCTGGTAAATATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-402s1c1
Sequence:CCGGCATGAACTTATCCAGTCACTTCTCGAGAAGTGACTGGATAAGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1626s1c1
Sequence:CCGGCCGAATCGTATTCCCAGTCTTCTCGAGAAGACTGGGAATACGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000810.2-1434s1c1
Sequence:CCGGGCGTGAAGTCATACTAAATAACTCGAGTTATTTAGTATGACTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks