EMAIL THIS PAGE TO A FRIEND

GABRA6

gamma-aminobutyric acid (GABA) A receptor, alpha 6

97 Gene Product Result for
UniProtKB ID: Q16445, A8K096, Q4VAV2
Gene ID:
Human(2559) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
Mouse(14399) gamma-aminobutyric acid (GABA) A receptor, subunit alpha 6
Rat(29708) gamma-aminobutyric acid (GABA) A receptor, alpha 6
domestic guinea pig(100720891) gamma-aminobutyric acid (GABA) A receptor, alpha 6
naked mole-rat(101720123) gamma-aminobutyric acid (GABA) A receptor, alpha 6
sheep(101117503) gamma-aminobutyric acid (GABA) A receptor, alpha 6
chicken(395931) gamma-aminobutyric acid (GABA) A receptor, alpha 6
cow(539194) gamma-aminobutyric acid (GABA) A receptor, alpha 6
Horse(100070890) gamma-aminobutyric acid (GABA) A receptor, alpha 6
domestic cat(101093992) gamma-aminobutyric acid (GABA) A receptor, alpha 6
dog(489145) gamma-aminobutyric acid (GABA) A receptor, alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000811 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000761 MISSION® esiRNA esiRNA targeting human GABRA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000811 Rosetta Predictions human pricing
NM_021841 Rosetta Predictions rat pricing
NM_001099641 Rosetta Predictions mouse pricing
NM_008068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178765 predicted 939
2 SASI_Hs01_00178766 predicted 1628
3 SASI_Hs01_00178767 predicted 808
4 SASI_Hs01_00178768 predicted 977
5 SASI_Hs02_00303274 predicted 363
6 SASI_Hs02_00303275 predicted 1670
7 SASI_Hs01_00178769 predicted 1762
8 SASI_Hs01_00178770 predicted 1299
9 SASI_Hs01_00178771 predicted 883
10 SASI_Hs01_00178774 predicted 1073
11 SASI_Hs01_00178772 predicted 944
12 SASI_Hs01_00178773 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043524 predicted 714
2 SASI_Rn01_00043526 predicted 508
3 SASI_Rn01_00043527 predicted 808
4 SASI_Rn01_00043528 predicted 478
5 SASI_Rn01_00043529 predicted 1088
6 SASI_Rn01_00043530 predicted 718
7 SASI_Rn01_00043531 predicted 663
8 SASI_Rn02_00262854 predicted 909
9 SASI_Rn01_00043532 predicted 567
10 SASI_Rn01_00043533 predicted 423
11 SASI_Rn01_00043525 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301925 predicted 1593
2 SASI_Mm02_00301926 predicted 1563
3 SASI_Mm02_00301927 predicted 791
4 SASI_Mm02_00301928 predicted 1629
5 SASI_Mm02_00301929 predicted 827
6 SASI_Mm02_00301930 predicted 941
7 SASI_Mm02_00301931 predicted 967
8 SASI_Mm02_00301932 predicted 1195
9 SASI_Mm02_00301933 predicted 1581
10 SASI_Mm02_00301934 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313053 predicted 1558
2 SASI_Mm01_00190535 predicted 1538
3 SASI_Mm01_00190537 predicted 762
4 SASI_Mm01_00190539 predicted 1593
5 SASI_Mm01_00190540 predicted 796
6 SASI_Mm01_00190541 predicted 913
7 SASI_Mm01_00190542 predicted 939
8 SASI_Mm02_00313054 predicted 1163
9 SASI_Mm02_00313055 predicted 1545
10 SASI_Mm02_00313056 predicted 968
11 SASI_Mm01_00190534 predicted 1265
12 SASI_Mm01_00190536 predicted 624
13 SASI_Mm01_00190538 predicted 601
14 SASI_Mm01_00190543 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008068
GABRA6 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008068.1-2213s1c1
Sequence:CCGGGCTGCAATACTGTTGCTATTTCTCGAGAAATAGCAACAGTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-604s1c1
Sequence:CCGGCCCAACAAGCTCTTCCGATTACTCGAGTAATCGGAAGAGCTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-1509s1c1
Sequence:CCGGCCTTGTGTACTGGATAGTTTACTCGAGTAAACTATCCAGTACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-945s1c1
Sequence:CCGGCCAGATATACACTCCGTGCATCTCGAGATGCACGGAGTGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-901s1c1
Sequence:CCGGACAGTCTATTTCCACTTACAACTCGAGTTGTAAGTGGAAATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008068
GABRA6 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008068.1-2213s1c1
Sequence:CCGGGCTGCAATACTGTTGCTATTTCTCGAGAAATAGCAACAGTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-604s1c1
Sequence:CCGGCCCAACAAGCTCTTCCGATTACTCGAGTAATCGGAAGAGCTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-1509s1c1
Sequence:CCGGCCTTGTGTACTGGATAGTTTACTCGAGTAAACTATCCAGTACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-945s1c1
Sequence:CCGGCCAGATATACACTCCGTGCATCTCGAGATGCACGGAGTGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-901s1c1
Sequence:CCGGACAGTCTATTTCCACTTACAACTCGAGTTGTAAGTGGAAATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008068
GABRA6 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008068.1-2213s1c1
Sequence:CCGGGCTGCAATACTGTTGCTATTTCTCGAGAAATAGCAACAGTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-604s1c1
Sequence:CCGGCCCAACAAGCTCTTCCGATTACTCGAGTAATCGGAAGAGCTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-1509s1c1
Sequence:CCGGCCTTGTGTACTGGATAGTTTACTCGAGTAAACTATCCAGTACACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-945s1c1
Sequence:CCGGCCAGATATACACTCCGTGCATCTCGAGATGCACGGAGTGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008068.1-901s1c1
Sequence:CCGGACAGTCTATTTCCACTTACAACTCGAGTTGTAAGTGGAAATAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000811
GABRA6 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-800s1c1
Sequence:CCGGCCAGGTGTCTTTCTGGATTAACTCGAGTTAATCCAGAAAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-960s1c1
Sequence:CCGGGCATTCGTCTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGACGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-78s1c1
Sequence:CCGGCTAGGGAAACTCGAAGTTGAACTCGAGTTCAACTTCGAGTTTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-1206s1c1
Sequence:CCGGGCGCCCATCTTACAATCAACACTCGAGTGTTGATTGTAAGATGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-418s1c1
Sequence:CCGGCTCCTAATAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTATTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000811.2-2160s21c1
Sequence:CCGGGGAGGCCTTTATGCTAGTAAACTCGAGTTTACTAGCATAAAGGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-980s21c1
Sequence:CCGGAGTATCTAGTGAGACAATTAACTCGAGTTAATTGTCTCACTAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-1060s21c1
Sequence:CCGGGCTACTTCATGATACAGATATCTCGAGATATCTGTATCATGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000811
GABRA6 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-800s1c1
Sequence:CCGGCCAGGTGTCTTTCTGGATTAACTCGAGTTAATCCAGAAAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-960s1c1
Sequence:CCGGGCATTCGTCTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGACGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-78s1c1
Sequence:CCGGCTAGGGAAACTCGAAGTTGAACTCGAGTTCAACTTCGAGTTTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-1206s1c1
Sequence:CCGGGCGCCCATCTTACAATCAACACTCGAGTGTTGATTGTAAGATGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-418s1c1
Sequence:CCGGCTCCTAATAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTATTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000811.2-2160s21c1
Sequence:CCGGGGAGGCCTTTATGCTAGTAAACTCGAGTTTACTAGCATAAAGGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-980s21c1
Sequence:CCGGAGTATCTAGTGAGACAATTAACTCGAGTTAATTGTCTCACTAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-1060s21c1
Sequence:CCGGGCTACTTCATGATACAGATATCTCGAGATATCTGTATCATGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000811
GABRA6 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, alpha 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-800s1c1
Sequence:CCGGCCAGGTGTCTTTCTGGATTAACTCGAGTTAATCCAGAAAGACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-960s1c1
Sequence:CCGGGCATTCGTCTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGACGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-78s1c1
Sequence:CCGGCTAGGGAAACTCGAAGTTGAACTCGAGTTCAACTTCGAGTTTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-1206s1c1
Sequence:CCGGGCGCCCATCTTACAATCAACACTCGAGTGTTGATTGTAAGATGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000811.1-418s1c1
Sequence:CCGGCTCCTAATAAACTCTTCAGAACTCGAGTTCTGAAGAGTTTATTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000811.2-2160s21c1
Sequence:CCGGGGAGGCCTTTATGCTAGTAAACTCGAGTTTACTAGCATAAAGGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-980s21c1
Sequence:CCGGAGTATCTAGTGAGACAATTAACTCGAGTTAATTGTCTCACTAGATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000811.2-1060s21c1
Sequence:CCGGGCTACTTCATGATACAGATATCTCGAGATATCTGTATCATGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks