EMAIL THIS PAGE TO A FRIEND

GABRB1

gamma-aminobutyric acid (GABA) A receptor, beta 1

84 Gene Product Result for
UniProtKB ID: P18505, B2R6U7, Q16166, Q8TBK3
Gene ID:
Human(2560) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
Mouse(14400) gamma-aminobutyric acid (GABA) A receptor, subunit beta 1
Rat(25450) gamma-aminobutyric acid (GABA) A receptor, beta 1
Zebrafish(100331377) gamma-aminobutyric acid (GABA) A receptor, beta 1
cow(282239) gamma-aminobutyric acid (GABA) A receptor, beta 1
domestic cat(101097640) gamma-aminobutyric acid (GABA) A receptor, beta 1
dog(100687745) gamma-aminobutyric acid (GABA) A receptor, beta 1
sheep(101122358) gamma-aminobutyric acid (GABA) A receptor, beta 1
naked mole-rat(101717539) gamma-aminobutyric acid (GABA) A receptor, beta 1
domestic guinea pig(100719515) gamma-aminobutyric acid (GABA) A receptor, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000812 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000812 Rosetta Predictions human pricing
NM_012956 Rosetta Predictions rat pricing
NM_008069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303276 predicted 804
2 SASI_Hs01_00096954 predicted 282
3 SASI_Hs01_00096955 predicted 1046
4 SASI_Hs01_00096956 predicted 392
5 SASI_Hs02_00303277 predicted 770
6 SASI_Hs01_00096957 predicted 755
7 SASI_Hs01_00096958 predicted 635
8 SASI_Hs01_00096960 predicted 983
9 SASI_Hs01_00096962 predicted 1431
10 SASI_Hs01_00096963 predicted 921
11 SASI_Hs01_00096959 predicted 1056
12 SASI_Hs01_00096961 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260544 predicted 1474
2 SASI_Rn01_00087141 predicted 365
3 SASI_Rn01_00087142 predicted 964
4 SASI_Rn01_00087144 predicted 354
5 SASI_Rn01_00087145 predicted 984
6 SASI_Rn01_00087146 predicted 1388
7 SASI_Rn01_00087147 predicted 1391
8 SASI_Rn01_00087148 predicted 622
9 SASI_Rn01_00087149 predicted 289
10 SASI_Rn01_00087150 predicted 817
11 SASI_Rn01_00087143 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313057 predicted 302
2 SASI_Mm01_00050635 predicted 1072
3 SASI_Mm01_00050636 predicted 273
4 SASI_Mm02_00313058 predicted 532
5 SASI_Mm01_00050639 predicted 473
6 SASI_Mm01_00050640 predicted 909
7 SASI_Mm01_00050641 predicted 888
8 SASI_Mm01_00050642 predicted 208
9 SASI_Mm01_00050643 predicted 226
10 SASI_Mm01_00050644 predicted 1107
11 SASI_Mm01_00050637 predicted 1409
12 SASI_Mm01_00050638 predicted 1399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000812
GABRB1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-565s1c1
Sequence:CCGGGCTGCATGTATGATGGATCTTCTCGAGAAGATCCATCATACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-981s1c1
Sequence:CCGGGCCAAAGATCCCTTATGTCAACTCGAGTTGACATAAGGGATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-354s1c1
Sequence:CCGGCCAGCAGTCTTGGAAAGACAACTCGAGTTGTCTTTCCAAGACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-123s1c1
Sequence:CCGGGCTTCTCTCTTTCCCTGTGATCTCGAGATCACAGGGAAAGAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-1434s1c1
Sequence:CCGGCATAGACAAGTGGTCCCGAATCTCGAGATTCGGGACCACTTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000812
GABRB1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-565s1c1
Sequence:CCGGGCTGCATGTATGATGGATCTTCTCGAGAAGATCCATCATACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-981s1c1
Sequence:CCGGGCCAAAGATCCCTTATGTCAACTCGAGTTGACATAAGGGATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-354s1c1
Sequence:CCGGCCAGCAGTCTTGGAAAGACAACTCGAGTTGTCTTTCCAAGACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-123s1c1
Sequence:CCGGGCTTCTCTCTTTCCCTGTGATCTCGAGATCACAGGGAAAGAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-1434s1c1
Sequence:CCGGCATAGACAAGTGGTCCCGAATCTCGAGATTCGGGACCACTTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000812
GABRB1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-565s1c1
Sequence:CCGGGCTGCATGTATGATGGATCTTCTCGAGAAGATCCATCATACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-981s1c1
Sequence:CCGGGCCAAAGATCCCTTATGTCAACTCGAGTTGACATAAGGGATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-354s1c1
Sequence:CCGGCCAGCAGTCTTGGAAAGACAACTCGAGTTGTCTTTCCAAGACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-123s1c1
Sequence:CCGGGCTTCTCTCTTTCCCTGTGATCTCGAGATCACAGGGAAAGAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000812.2-1434s1c1
Sequence:CCGGCATAGACAAGTGGTCCCGAATCTCGAGATTCGGGACCACTTGTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008069
GABRB1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-355s1c1
Sequence:CCGGCCAGACACCTACTTTCTCAATCTCGAGATTGAGAAAGTAGGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-227s1c1
Sequence:CCGGCGGAAGTGAATATGGATTATACTCGAGTATAATCCATATTCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-47s1c1
Sequence:CCGGCCGTGATGGTTGCTATGGTTTCTCGAGAAACCATAGCAACCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-1396s1c1
Sequence:CCGGGTCGTTTATTGGCTTTACTATCTCGAGATAGTAAAGCCAATAAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008069.3-1579s1c1
Sequence:CCGGCCATGTTTACTTCAACAACAACTCGAGTTGTTGTTGAAGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008069
GABRB1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-355s1c1
Sequence:CCGGCCAGACACCTACTTTCTCAATCTCGAGATTGAGAAAGTAGGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-227s1c1
Sequence:CCGGCGGAAGTGAATATGGATTATACTCGAGTATAATCCATATTCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-47s1c1
Sequence:CCGGCCGTGATGGTTGCTATGGTTTCTCGAGAAACCATAGCAACCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-1396s1c1
Sequence:CCGGGTCGTTTATTGGCTTTACTATCTCGAGATAGTAAAGCCAATAAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008069.3-1579s1c1
Sequence:CCGGCCATGTTTACTTCAACAACAACTCGAGTTGTTGTTGAAGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008069
GABRB1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-355s1c1
Sequence:CCGGCCAGACACCTACTTTCTCAATCTCGAGATTGAGAAAGTAGGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-227s1c1
Sequence:CCGGCGGAAGTGAATATGGATTATACTCGAGTATAATCCATATTCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-47s1c1
Sequence:CCGGCCGTGATGGTTGCTATGGTTTCTCGAGAAACCATAGCAACCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008069.3-1396s1c1
Sequence:CCGGGTCGTTTATTGGCTTTACTATCTCGAGATAGTAAAGCCAATAAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008069.3-1579s1c1
Sequence:CCGGCCATGTTTACTTCAACAACAACTCGAGTTGTTGTTGAAGTAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks