EMAIL THIS PAGE TO A FRIEND

GABRB2

gamma-aminobutyric acid (GABA) A receptor, beta 2

304 Gene Product Result for
Gene ID:
Human(2561) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
Mouse(14401) gamma-aminobutyric acid (GABA) A receptor, subunit beta 2
Rat(25451) gamma-aminobutyric acid (GABA) A receptor, beta 2
domestic guinea pig(100720162) gamma-aminobutyric acid (GABA) A receptor, beta 2
naked mole-rat(101721168) gamma-aminobutyric acid (GABA) A receptor, beta 2
sheep(100913155) gamma-aminobutyric acid (GABA) A receptor, beta 2
Domestic Rabbit(100356357) gamma-aminobutyric acid (GABA) A receptor, beta 2
Zebrafish(336252) gamma-aminobutyric acid (GABA) A receptor, beta 2
domestic cat(101094237) gamma-aminobutyric acid (GABA) A receptor, beta 2
cow(540657) gamma-aminobutyric acid (GABA) A receptor, beta 2
Horse(100059608) gamma-aminobutyric acid (GABA) A receptor, beta 2
dog(489146) gamma-aminobutyric acid (GABA) A receptor, beta 2
chicken(414890) gamma-aminobutyric acid (GABA) A receptor, beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C4024 Carbamazepine powder human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0282 AQUA Peptide FSTGSYP[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000813 Rosetta Predictions human pricing
NM_021911 Rosetta Predictions human pricing
NM_012957 Rosetta Predictions rat pricing
NM_008070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303278 predicted 1577
2 SASI_Hs02_00303279 predicted 425
3 SASI_Hs02_00303280 predicted 291
4 SASI_Hs02_00303281 predicted 305
5 SASI_Hs01_00091809 predicted 503
6 SASI_Hs02_00303282 predicted 972
7 SASI_Hs02_00303283 predicted 736
8 SASI_Hs01_00091810 predicted 512
9 SASI_Hs02_00303284 predicted 338
10 SASI_Hs02_00303285 predicted 841
11 SASI_Hs01_00091807 predicted 498
12 SASI_Hs01_00091808 predicted 836
13 SASI_Hs01_00091811 predicted 1064
14 SASI_Hs01_00091812 predicted 909
15 SASI_Hs01_00091813 predicted 755
16 SASI_Hs01_00091814 predicted 770
17 SASI_Hs01_00091815 predicted 795
18 SASI_Hs01_00091816 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355183 predicted 1689
2 SASI_Hs02_00355184 predicted 421
3 SASI_Hs02_00355185 predicted 289
4 SASI_Hs02_00355186 predicted 302
5 SASI_Hs01_00237611 predicted 496
6 SASI_Hs02_00355187 predicted 969
7 SASI_Hs02_00355188 predicted 736
8 SASI_Hs01_00237612 predicted 514
9 SASI_Hs02_00355189 predicted 331
10 SASI_Hs02_00355190 predicted 838
11 SASI_Hs01_00237609 predicted 498
12 SASI_Hs01_00237610 predicted 844
13 SASI_Hs01_00237613 predicted 1069
14 SASI_Hs01_00237614 predicted 905
15 SASI_Hs01_00237615 predicted 756
16 SASI_Hs01_00237616 predicted 768
17 SASI_Hs01_00237617 predicted 798
18 SASI_Hs01_00237618 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260545 predicted 752
2 SASI_Rn01_00032234 predicted 599
3 SASI_Rn02_00260546 predicted 541
4 SASI_Rn02_00260547 predicted 1033
5 SASI_Rn02_00260548 predicted 683
6 SASI_Rn01_00032241 predicted 296
7 SASI_Rn01_00032242 predicted 234
8 SASI_Rn01_00032243 predicted 909
9 SASI_Rn02_00260549 predicted 272
10 SASI_Rn02_00260550 predicted 435
11 SASI_Rn01_00032235 predicted 1165
12 SASI_Rn01_00032236 predicted 1529
13 SASI_Rn01_00032237 predicted 615
14 SASI_Rn01_00032238 predicted 1255
15 SASI_Rn01_00032239 predicted 895
16 SASI_Rn01_00032240 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195315 predicted 1044
2 SASI_Mm01_00195316 predicted 511
3 SASI_Mm01_00195317 predicted 1179
4 SASI_Mm01_00195318 predicted 656
5 SASI_Mm01_00195319 predicted 942
6 SASI_Mm01_00195320 predicted 505
7 SASI_Mm01_00195321 predicted 601
8 SASI_Mm01_00195322 predicted 1816
9 SASI_Mm01_00195323 predicted 716
10 SASI_Mm01_00195324 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008070
GABRB2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008070.2-2133s1c1
Sequence:CCGGGCCTACTTAGAGGGTTATTATCTCGAGATAATAACCCTCTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1274s1c1
Sequence:CCGGCCTAACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-780s1c1
Sequence:CCGGCCTGACACCTACTTCCTGAATCTCGAGATTCAGGAAGTAGGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1181s1c1
Sequence:CCGGGCCATCAATTCTGATTACCATCTCGAGATGGTAATCAGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1182s1c1
Sequence:CCGGCCATCAATTCTGATTACCATTCTCGAGAATGGTAATCAGAATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008070
GABRB2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008070.2-2133s1c1
Sequence:CCGGGCCTACTTAGAGGGTTATTATCTCGAGATAATAACCCTCTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1274s1c1
Sequence:CCGGCCTAACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-780s1c1
Sequence:CCGGCCTGACACCTACTTCCTGAATCTCGAGATTCAGGAAGTAGGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1181s1c1
Sequence:CCGGGCCATCAATTCTGATTACCATCTCGAGATGGTAATCAGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1182s1c1
Sequence:CCGGCCATCAATTCTGATTACCATTCTCGAGAATGGTAATCAGAATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008070
GABRB2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008070.2-2133s1c1
Sequence:CCGGGCCTACTTAGAGGGTTATTATCTCGAGATAATAACCCTCTAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1274s1c1
Sequence:CCGGCCTAACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-780s1c1
Sequence:CCGGCCTGACACCTACTTCCTGAATCTCGAGATTCAGGAAGTAGGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1181s1c1
Sequence:CCGGGCCATCAATTCTGATTACCATCTCGAGATGGTAATCAGAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008070.2-1182s1c1
Sequence:CCGGCCATCAATTCTGATTACCATTCTCGAGAATGGTAATCAGAATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000813
GABRB2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, beta 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-795s1c1
Sequence:CCGGCGTGGCGATGATAATGCAGTACTCGAGTACTGCATTATCATCGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1578s1c1
Sequence:CCGGCGCATATTCTTCCCAGTGGTTCTCGAGAACCACTGGGAAGAATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1064s1c1
Sequence:CCGGCCTCACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-584s1c1
Sequence:CCGGCCTGAACGATAAGAAGTCATTCTCGAGAATGACTTCTTATCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-306s1c1
Sequence:CCGGCCTAGTAATATGTCGCTGGTTCTCGAGAACCAGCGACATATTACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-1766s21c1
Sequence:CCGGGGCCTATCCTGTGGTCCATTTCTCGAGAAATGGACCACAGGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-495s21c1
Sequence:CCGGGATAAGAGGCTGTCCTATAATCTCGAGATTATAGGACAGCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-647s21c1
Sequence:CCGGTCCTGATGGCACCGTCCTTTACTCGAGTAAAGGACGGTGCCATCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-2084s21c1
Sequence:CCGGATTACTTGAAGATGATCTATGCTCGAGCATAGATCATCTTCAAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000813
GABRB2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, beta 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-795s1c1
Sequence:CCGGCGTGGCGATGATAATGCAGTACTCGAGTACTGCATTATCATCGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1578s1c1
Sequence:CCGGCGCATATTCTTCCCAGTGGTTCTCGAGAACCACTGGGAAGAATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1064s1c1
Sequence:CCGGCCTCACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-584s1c1
Sequence:CCGGCCTGAACGATAAGAAGTCATTCTCGAGAATGACTTCTTATCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-306s1c1
Sequence:CCGGCCTAGTAATATGTCGCTGGTTCTCGAGAACCAGCGACATATTACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-1766s21c1
Sequence:CCGGGGCCTATCCTGTGGTCCATTTCTCGAGAAATGGACCACAGGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-495s21c1
Sequence:CCGGGATAAGAGGCTGTCCTATAATCTCGAGATTATAGGACAGCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-647s21c1
Sequence:CCGGTCCTGATGGCACCGTCCTTTACTCGAGTAAAGGACGGTGCCATCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-2084s21c1
Sequence:CCGGATTACTTGAAGATGATCTATGCTCGAGCATAGATCATCTTCAAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000813
GABRB2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, beta 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-795s1c1
Sequence:CCGGCGTGGCGATGATAATGCAGTACTCGAGTACTGCATTATCATCGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1578s1c1
Sequence:CCGGCGCATATTCTTCCCAGTGGTTCTCGAGAACCACTGGGAAGAATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-1064s1c1
Sequence:CCGGCCTCACAATGACCACAATCAACTCGAGTTGATTGTGGTCATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-584s1c1
Sequence:CCGGCCTGAACGATAAGAAGTCATTCTCGAGAATGACTTCTTATCGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000813.1-306s1c1
Sequence:CCGGCCTAGTAATATGTCGCTGGTTCTCGAGAACCAGCGACATATTACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-1766s21c1
Sequence:CCGGGGCCTATCCTGTGGTCCATTTCTCGAGAAATGGACCACAGGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-495s21c1
Sequence:CCGGGATAAGAGGCTGTCCTATAATCTCGAGATTATAGGACAGCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000813.2-647s21c1
Sequence:CCGGTCCTGATGGCACCGTCCTTTACTCGAGTAAAGGACGGTGCCATCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000813.2-2084s21c1
Sequence:CCGGATTACTTGAAGATGATCTATGCTCGAGCATAGATCATCTTCAAGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks