EMAIL THIS PAGE TO A FRIEND

GABRD

gamma-aminobutyric acid (GABA) A receptor, delta

55 Gene Product Result for
Synonyms: EIG10 EJM7 GEFSP5
UniProtKB ID: O14764, Q8N4N9
Gene ID:
Human(2563) Summary: Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14403) gamma-aminobutyric acid (GABA) A receptor, subunit delta
Rat(29689) gamma-aminobutyric acid (GABA) A receptor, delta
domestic guinea pig(100735228) gamma-aminobutyric acid (GABA) A receptor, delta
naked mole-rat(101700143) gamma-aminobutyric acid (GABA) A receptor, delta
sheep(101122539) gamma-aminobutyric acid (GABA) A receptor, delta
Zebrafish(571422) gamma-aminobutyric acid (GABA) A receptor, delta
chicken(770710) gamma-aminobutyric acid (GABA) A receptor, delta
dog(489609) gamma-aminobutyric acid (GABA) A receptor, delta
cow(508711) gamma-aminobutyric acid (GABA) A receptor, delta
domestic cat(101087589) gamma-aminobutyric acid (GABA) A receptor, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000815 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000815 Rosetta Predictions human pricing
NM_017289 Rosetta Predictions rat pricing
NM_008072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161990 predicted 1402
2 SASI_Hs01_00161991 predicted 347
3 SASI_Hs01_00161992 predicted 1498
4 SASI_Hs01_00161993 predicted 1250
5 SASI_Hs01_00161994 predicted 651
6 SASI_Hs02_00303287 predicted 1097
7 SASI_Hs01_00161995 predicted 1391
8 SASI_Hs01_00161996 predicted 1069
9 SASI_Hs01_00161997 predicted 1127
10 SASI_Hs01_00161998 predicted 1357
11 SASI_Hs01_00161989 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044328 predicted 532
2 SASI_Rn02_00261727 predicted 623
3 SASI_Rn01_00044329 predicted 613
4 SASI_Rn01_00044330 predicted 1376
5 SASI_Rn01_00044331 predicted 902
6 SASI_Rn01_00044332 predicted 269
7 SASI_Rn02_00261728 predicted 274
8 SASI_Rn01_00044333 predicted 231
9 SASI_Rn01_00044334 predicted 964
10 SASI_Rn01_00044336 predicted 1384
11 SASI_Rn01_00044335 predicted 1421
12 SASI_Rn01_00044337 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071735 predicted 597
2 SASI_Mm01_00071736 predicted 671
3 SASI_Mm01_00071737 predicted 674
4 SASI_Mm01_00071739 predicted 1016
5 SASI_Mm01_00071740 predicted 317
6 SASI_Mm01_00071741 predicted 1026
7 SASI_Mm01_00071742 predicted 327
8 SASI_Mm01_00071743 predicted 1480
9 SASI_Mm02_00313061 predicted 847
10 SASI_Mm01_00071744 predicted 743
11 SASI_Mm01_00071738 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008072
GABRD MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, delta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008072.1-1565s1c1
Sequence:CCGGCTTGGGCTTTACCTCAACTTTCTCGAGAAAGTTGAGGTAAAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-1361s1c1
Sequence:CCGGGCAGACACCATCGACATCTATCTCGAGATAGATGTCGATGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-397s1c1
Sequence:CCGGGCTGTCCTACAACCATACCAACTCGAGTTGGTATGGTTGTAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-736s1c1
Sequence:CCGGCCAGTTCACTATCACCAGTTACTCGAGTAACTGGTGATAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-164s1c1
Sequence:CCGGGCCAGGGCAATGAATGACATTCTCGAGAATGTCATTCATTGCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008072
GABRD MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, delta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008072.1-1565s1c1
Sequence:CCGGCTTGGGCTTTACCTCAACTTTCTCGAGAAAGTTGAGGTAAAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-1361s1c1
Sequence:CCGGGCAGACACCATCGACATCTATCTCGAGATAGATGTCGATGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-397s1c1
Sequence:CCGGGCTGTCCTACAACCATACCAACTCGAGTTGGTATGGTTGTAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-736s1c1
Sequence:CCGGCCAGTTCACTATCACCAGTTACTCGAGTAACTGGTGATAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-164s1c1
Sequence:CCGGGCCAGGGCAATGAATGACATTCTCGAGAATGTCATTCATTGCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008072
GABRD MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, delta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008072.1-1565s1c1
Sequence:CCGGCTTGGGCTTTACCTCAACTTTCTCGAGAAAGTTGAGGTAAAGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-1361s1c1
Sequence:CCGGGCAGACACCATCGACATCTATCTCGAGATAGATGTCGATGGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-397s1c1
Sequence:CCGGGCTGTCCTACAACCATACCAACTCGAGTTGGTATGGTTGTAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-736s1c1
Sequence:CCGGCCAGTTCACTATCACCAGTTACTCGAGTAACTGGTGATAGTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-164s1c1
Sequence:CCGGGCCAGGGCAATGAATGACATTCTCGAGAATGTCATTCATTGCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000815
GABRD MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, delta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-91s1c1
Sequence:CCGGGATGAATGACATCGGCGACTACTCGAGTAGTCGCCGATGTCATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-574s1c1
Sequence:CCGGCGGTTACTCATCGGAGGACATCTCGAGATGTCCTCCGATGAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1009s1c1
Sequence:CCGGTGCTCATTTCAACGCCGACTACTCGAGTAGTCGGCGTTGAAATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1288s1c1
Sequence:CCGGCGCAGACACCATTGACATTTACTCGAGTAAATGTCAATGGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-880s1c1
Sequence:CCGGGCTGACGATGACCACGCTCATCTCGAGATGAGCGTGGTCATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000815
GABRD MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, delta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-91s1c1
Sequence:CCGGGATGAATGACATCGGCGACTACTCGAGTAGTCGCCGATGTCATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-574s1c1
Sequence:CCGGCGGTTACTCATCGGAGGACATCTCGAGATGTCCTCCGATGAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1009s1c1
Sequence:CCGGTGCTCATTTCAACGCCGACTACTCGAGTAGTCGGCGTTGAAATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1288s1c1
Sequence:CCGGCGCAGACACCATTGACATTTACTCGAGTAAATGTCAATGGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-880s1c1
Sequence:CCGGGCTGACGATGACCACGCTCATCTCGAGATGAGCGTGGTCATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000815
GABRD MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, delta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-91s1c1
Sequence:CCGGGATGAATGACATCGGCGACTACTCGAGTAGTCGCCGATGTCATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-574s1c1
Sequence:CCGGCGGTTACTCATCGGAGGACATCTCGAGATGTCCTCCGATGAGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1009s1c1
Sequence:CCGGTGCTCATTTCAACGCCGACTACTCGAGTAGTCGGCGTTGAAATGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1288s1c1
Sequence:CCGGCGCAGACACCATTGACATTTACTCGAGTAAATGTCAATGGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-880s1c1
Sequence:CCGGGCTGACGATGACCACGCTCATCTCGAGATGAGCGTGGTCATCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks