EMAIL THIS PAGE TO A FRIEND

GABRE

gamma-aminobutyric acid (GABA) A receptor, epsilon

211 Gene Product Result for
UniProtKB ID: P78334, O15345, O15346, Q99520
Gene ID:
Human(2564) Summary: The product of this gene belongs to the ligand-gated ionic channel (TC 1.A.9) family. It encodes the gamma-aminobutyric acid (GABA) A receptor which is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes an epsilon subunit. It is mapped to chromosome Xq28 in a cluster comprised of genes encoding alpha 3, beta 4 and theta subunits of the same receptor. Alternatively spliced transcript variants have been identified, but only one is thought to encode a protein. [provided by RefSeq, Oct 2008]
Mouse(14404) gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Rat(65191) gamma-aminobutyric acid (GABA) A receptor, epsilon
chicken(396173) gamma-aminobutyric acid (GABA) A receptor, epsilon
cow(524115) gamma-aminobutyric acid (GABA) A receptor, epsilon
Horse(100069261) gamma-aminobutyric acid (GABA) A receptor, epsilon
domestic cat(101095805) gamma-aminobutyric acid (GABA) A receptor, epsilon
dog(492220) gamma-aminobutyric acid (GABA) A receptor, epsilon
sheep(101106150) gamma-aminobutyric acid (GABA) A receptor, epsilon
Domestic Rabbit(100349357) gamma-aminobutyric acid (GABA) A receptor, epsilon
naked mole-rat(101722562) gamma-aminobutyric acid (GABA) A receptor, epsilon
domestic guinea pig(100729952) gamma-aminobutyric acid (GABA) A receptor, epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004961 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063951 MISSION® esiRNA esiRNA human GABRE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004961 Rosetta Predictions human pricing
NM_021984 Rosetta Predictions human pricing
NM_021987 Rosetta Predictions human pricing
NM_021990 Rosetta Predictions human pricing
NM_023091 Rosetta Predictions rat pricing
NM_017369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221442 predicted 1902
2 SASI_Hs01_00221443 predicted 881
3 SASI_Hs01_00221444 predicted 1951
4 SASI_Hs01_00221445 predicted 1388
5 SASI_Hs01_00221446 predicted 824
6 SASI_Hs01_00221447 predicted 984
7 SASI_Hs01_00221448 predicted 1929
8 SASI_Hs01_00221449 predicted 1859
9 SASI_Hs01_00221450 predicted 839
10 SASI_Hs02_00338646 predicted 1539
11 SASI_Hs01_00221451 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076459 predicted 2074
2 SASI_Hs01_00076460 predicted 1056
3 SASI_Hs01_00076461 predicted 2138
4 SASI_Hs01_00076462 predicted 1562
5 SASI_Hs01_00076463 predicted 1007
6 SASI_Hs01_00076464 predicted 1166
7 SASI_Hs01_00076465 predicted 2105
8 SASI_Hs01_00076466 predicted 2032
9 SASI_Hs01_00076467 predicted 1016
10 SASI_Hs02_00355355 predicted 1715
11 SASI_Hs01_00076468 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055022 predicted 1980
2 SASI_Hs01_00055023 predicted 966
3 SASI_Hs01_00055024 predicted 2040
4 SASI_Hs01_00055025 predicted 1474
5 SASI_Hs01_00055026 predicted 908
6 SASI_Hs01_00055027 predicted 1069
7 SASI_Hs01_00055028 predicted 2008
8 SASI_Hs01_00055029 predicted 1942
9 SASI_Hs01_00055030 predicted 921
10 SASI_Hs02_00355356 predicted 1615
11 SASI_Hs01_00055031 predicted 1916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065220 predicted 2808
2 SASI_Hs01_00065221 predicted 1794
3 SASI_Hs01_00065222 predicted 2871
4 SASI_Hs01_00065223 predicted 2306
5 SASI_Hs01_00065224 predicted 1740
6 SASI_Hs01_00065225 predicted 1897
7 SASI_Hs01_00065226 predicted 2843
8 SASI_Hs01_00065227 predicted 2767
9 SASI_Hs01_00065228 predicted 1747
10 SASI_Hs02_00355357 predicted 2448
11 SASI_Hs01_00065229 predicted 2743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071318 predicted 2182
2 SASI_Rn01_00071319 predicted 2020
3 SASI_Rn01_00071320 predicted 1785
4 SASI_Rn01_00071321 predicted 1882
5 SASI_Rn01_00071322 predicted 1776
6 SASI_Rn01_00071323 predicted 2269
7 SASI_Rn01_00071324 predicted 2046
8 SASI_Rn01_00071325 predicted 1760
9 SASI_Rn01_00071326 predicted 1841
10 SASI_Rn01_00071327 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023769 predicted 2273
2 SASI_Mm01_00023771 predicted 2218
3 SASI_Mm01_00023772 predicted 2523
4 SASI_Mm02_00323847 predicted 2365
5 SASI_Mm01_00023773 predicted 1801
6 SASI_Mm01_00023774 predicted 1957
7 SASI_Mm01_00023776 predicted 1787
8 SASI_Mm01_00023775 predicted 2389
9 SASI_Mm01_00023777 predicted 1799
10 SASI_Mm01_00023778 predicted 1624
11 SASI_Mm01_00023770 predicted 1637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004961
GABRE MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, epsilon
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-682s1c1
Sequence:CCGGCCTCTATCTTTCTCTAGCTTTCTCGAGAAAGCTAGAGAAAGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-444s1c1
Sequence:CCGGCCTCTGTTACAACGACACCTTCTCGAGAAGGTGTCGTTGTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-1518s1c1
Sequence:CCGGCCCAGTGACTTTCTTCTTCTTCTCGAGAAGAAGAAGAAAGTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-747s1c1
Sequence:CCGGGCTTGAAATCAATGAGAAGAACTCGAGTTCTTCTCATTGATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-288s1c1
Sequence:CCGGCCTGAGTAATTATGACCACAACTCGAGTTGTGGTCATAATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004961
GABRE MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, epsilon
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-682s1c1
Sequence:CCGGCCTCTATCTTTCTCTAGCTTTCTCGAGAAAGCTAGAGAAAGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-444s1c1
Sequence:CCGGCCTCTGTTACAACGACACCTTCTCGAGAAGGTGTCGTTGTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-1518s1c1
Sequence:CCGGCCCAGTGACTTTCTTCTTCTTCTCGAGAAGAAGAAGAAAGTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-747s1c1
Sequence:CCGGGCTTGAAATCAATGAGAAGAACTCGAGTTCTTCTCATTGATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-288s1c1
Sequence:CCGGCCTGAGTAATTATGACCACAACTCGAGTTGTGGTCATAATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004961
GABRE MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, epsilon
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-682s1c1
Sequence:CCGGCCTCTATCTTTCTCTAGCTTTCTCGAGAAAGCTAGAGAAAGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-444s1c1
Sequence:CCGGCCTCTGTTACAACGACACCTTCTCGAGAAGGTGTCGTTGTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-1518s1c1
Sequence:CCGGCCCAGTGACTTTCTTCTTCTTCTCGAGAAGAAGAAGAAAGTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-747s1c1
Sequence:CCGGGCTTGAAATCAATGAGAAGAACTCGAGTTCTTCTCATTGATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-288s1c1
Sequence:CCGGCCTGAGTAATTATGACCACAACTCGAGTTGTGGTCATAATTACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017369
GABRE MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, epsilon
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-241s1c1
Sequence:CCGGGCCATGATGATGTAGTCTTTACTCGAGTAAAGACTACATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-2382s1c1
Sequence:CCGGCCAACCAATAGCCGTGCTAATCTCGAGATTAGCACGGCTATTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1476s1c1
Sequence:CCGGCTGAGCAACTATGACCATAAACTCGAGTTTATGGTCATAGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-84s1c1
Sequence:CCGGCCTCATGTTAATCTGGAGAATCTCGAGATTCTCCAGATTAACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1475s1c1
Sequence:CCGGCCTGAGCAACTATGACCATAACTCGAGTTATGGTCATAGTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017369
GABRE MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, epsilon
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-241s1c1
Sequence:CCGGGCCATGATGATGTAGTCTTTACTCGAGTAAAGACTACATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-2382s1c1
Sequence:CCGGCCAACCAATAGCCGTGCTAATCTCGAGATTAGCACGGCTATTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1476s1c1
Sequence:CCGGCTGAGCAACTATGACCATAAACTCGAGTTTATGGTCATAGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-84s1c1
Sequence:CCGGCCTCATGTTAATCTGGAGAATCTCGAGATTCTCCAGATTAACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1475s1c1
Sequence:CCGGCCTGAGCAACTATGACCATAACTCGAGTTATGGTCATAGTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017369
GABRE MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, epsilon
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-241s1c1
Sequence:CCGGGCCATGATGATGTAGTCTTTACTCGAGTAAAGACTACATCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-2382s1c1
Sequence:CCGGCCAACCAATAGCCGTGCTAATCTCGAGATTAGCACGGCTATTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1476s1c1
Sequence:CCGGCTGAGCAACTATGACCATAAACTCGAGTTTATGGTCATAGTTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-84s1c1
Sequence:CCGGCCTCATGTTAATCTGGAGAATCTCGAGATTCTCCAGATTAACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1475s1c1
Sequence:CCGGCCTGAGCAACTATGACCATAACTCGAGTTATGGTCATAGTTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks