EMAIL THIS PAGE TO A FRIEND

GABRG1

gamma-aminobutyric acid (GABA) A receptor, gamma 1

82 Gene Product Result for
UniProtKB ID: Q8N1C3, Q5H9T8
Gene ID:
Human(2565) Summary: The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Mouse(14405) gamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
Rat(140674) gamma-aminobutyric acid (GABA) A receptor, gamma 1
domestic guinea pig(100718407) gamma-aminobutyric acid (GABA) A receptor, gamma 1
naked mole-rat(101721607) gamma-aminobutyric acid (GABA) A receptor, gamma 1
sheep(101121012) gamma-aminobutyric acid (GABA) A receptor, gamma 1
chicken(422771) gamma-aminobutyric acid (GABA) A receptor, gamma 1
domestic cat(101099123) gamma-aminobutyric acid (GABA) A receptor, gamma 1
cow(615885) gamma-aminobutyric acid (GABA) A receptor, gamma 1
dog(482130) gamma-aminobutyric acid (GABA) A receptor, gamma 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
F6300 Flumazenil >99% (HPLC), solid human, rat pricing
R109 Ro 15-4513 solid human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3539 3-Amino-2,3-dihydrobenzoic acid hydrochloride ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173536 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173536 Rosetta Predictions human pricing
NM_080586 Rosetta Predictions rat pricing
NM_010252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140791 predicted 707
2 SASI_Hs01_00140792 predicted 414
3 SASI_Hs01_00140793 predicted 678
4 SASI_Hs01_00140794 predicted 692
5 SASI_Hs01_00140795 predicted 529
6 SASI_Hs01_00140796 predicted 436
7 SASI_Hs01_00140797 predicted 445
8 SASI_Hs01_00140798 predicted 1519
9 SASI_Hs01_00140799 predicted 360
10 SASI_Hs01_00140800 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032284 predicted 711
2 SASI_Rn01_00032285 predicted 355
3 SASI_Rn01_00032286 predicted 1476
4 SASI_Rn02_00267261 predicted 1487
5 SASI_Rn01_00032287 predicted 1038
6 SASI_Rn01_00032288 predicted 778
7 SASI_Rn01_00032289 predicted 645
8 SASI_Rn01_00032290 predicted 636
9 SASI_Rn01_00032292 predicted 1144
10 SASI_Rn01_00032293 predicted 820
11 SASI_Rn01_00032291 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109477 predicted 1427
2 SASI_Mm02_00318143 predicted 783
3 SASI_Mm01_00109478 predicted 922
4 SASI_Mm01_00109479 predicted 620
5 SASI_Mm01_00109481 predicted 777
6 SASI_Mm01_00109482 predicted 1589
7 SASI_Mm01_00109483 predicted 720
8 SASI_Mm02_00318144 predicted 717
9 SASI_Mm01_00109484 predicted 937
10 SASI_Mm01_00109485 predicted 580
11 SASI_Mm01_00109476 predicted 1847
12 SASI_Mm01_00109480 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010252
GABRG1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010252.3-4440s1c1
Sequence:CCGGCCGATTTACAAGACCAGGATTCTCGAGAATCCTGGTCTTGTAAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-752s1c1
Sequence:CCGGCCTGGTTTGACAGCCGTTTAACTCGAGTTAAACGGCTGTCAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-955s1c1
Sequence:CCGGGCAGAGTGCTACCTTCAACTTCTCGAGAAGTTGAAGGTAGCACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-1344s1c1
Sequence:CCGGCCTCAGTACAATTGCTAGAAACTCGAGTTTCTAGCAATTGTACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-460s1c1
Sequence:CCGGGTGAGGTTGATATTCTTGTTACTCGAGTAACAAGAATATCAACCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-719s21c1
Sequence:CCGGGGAGTATACAATAGACATAATCTCGAGATTATGTCTATTGTATACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1448s21c1
Sequence:CCGGATACGGAACCTTGCATTATTTCTCGAGAAATAATGCAAGGTTCCGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-890s21c1
Sequence:CCGGTAATCGCCTGCTGCGGATTTGCTCGAGCAAATCCGCAGCAGGCGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1769s21c1
Sequence:CCGGTTACTGGGTTGGGTATCTATACTCGAGTATAGATACCCAACCCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010252
GABRG1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010252.3-4440s1c1
Sequence:CCGGCCGATTTACAAGACCAGGATTCTCGAGAATCCTGGTCTTGTAAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-752s1c1
Sequence:CCGGCCTGGTTTGACAGCCGTTTAACTCGAGTTAAACGGCTGTCAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-955s1c1
Sequence:CCGGGCAGAGTGCTACCTTCAACTTCTCGAGAAGTTGAAGGTAGCACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-1344s1c1
Sequence:CCGGCCTCAGTACAATTGCTAGAAACTCGAGTTTCTAGCAATTGTACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-460s1c1
Sequence:CCGGGTGAGGTTGATATTCTTGTTACTCGAGTAACAAGAATATCAACCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-719s21c1
Sequence:CCGGGGAGTATACAATAGACATAATCTCGAGATTATGTCTATTGTATACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1448s21c1
Sequence:CCGGATACGGAACCTTGCATTATTTCTCGAGAAATAATGCAAGGTTCCGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-890s21c1
Sequence:CCGGTAATCGCCTGCTGCGGATTTGCTCGAGCAAATCCGCAGCAGGCGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1769s21c1
Sequence:CCGGTTACTGGGTTGGGTATCTATACTCGAGTATAGATACCCAACCCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010252
GABRG1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010252.3-4440s1c1
Sequence:CCGGCCGATTTACAAGACCAGGATTCTCGAGAATCCTGGTCTTGTAAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-752s1c1
Sequence:CCGGCCTGGTTTGACAGCCGTTTAACTCGAGTTAAACGGCTGTCAAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-955s1c1
Sequence:CCGGGCAGAGTGCTACCTTCAACTTCTCGAGAAGTTGAAGGTAGCACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-1344s1c1
Sequence:CCGGCCTCAGTACAATTGCTAGAAACTCGAGTTTCTAGCAATTGTACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-460s1c1
Sequence:CCGGGTGAGGTTGATATTCTTGTTACTCGAGTAACAAGAATATCAACCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-719s21c1
Sequence:CCGGGGAGTATACAATAGACATAATCTCGAGATTATGTCTATTGTATACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1448s21c1
Sequence:CCGGATACGGAACCTTGCATTATTTCTCGAGAAATAATGCAAGGTTCCGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-890s21c1
Sequence:CCGGTAATCGCCTGCTGCGGATTTGCTCGAGCAAATCCGCAGCAGGCGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1769s21c1
Sequence:CCGGTTACTGGGTTGGGTATCTATACTCGAGTATAGATACCCAACCCAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173536
GABRG1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000430962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-644s21c1
Sequence:CCGGTAATCGTCTGCTTCGAATTTGCTCGAGCAAATTCGAAGCAGACGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-548s21c1
Sequence:CCGGGCTTATGCTTAACAGTAATATCTCGAGATATTACTGTTAAGCATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173536
GABRG1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000430962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-644s21c1
Sequence:CCGGTAATCGTCTGCTTCGAATTTGCTCGAGCAAATTCGAAGCAGACGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-548s21c1
Sequence:CCGGGCTTATGCTTAACAGTAATATCTCGAGATATTACTGTTAAGCATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173536
GABRG1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000430962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-644s21c1
Sequence:CCGGTAATCGTCTGCTTCGAATTTGCTCGAGCAAATTCGAAGCAGACGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-548s21c1
Sequence:CCGGGCTTATGCTTAACAGTAATATCTCGAGATATTACTGTTAAGCATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)