EMAIL THIS PAGE TO A FRIEND

GABRG2

gamma-aminobutyric acid (GABA) A receptor, gamma 2

245 Gene Product Result for
Synonyms: CAE2 ECA2 GEFSP3
UniProtKB ID: P18507, F5HB82, Q6GRL6, Q6PCC3, Q9UDB3, Q9UN15
Gene ID:
Human(2566) Summary: This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammlian brain, where it acts at GABA-A receptors, which are ligand-gated chloride channels. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene have been associated with epilepsy and febrile seizures. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14406) gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Rat(29709) gamma-aminobutyric acid (GABA) A receptor, gamma 2
Zebrafish(553402) gamma-aminobutyric acid (GABA) A receptor, gamma 2
chicken(396289) gamma-aminobutyric acid (GABA) A receptor, gamma 2
cow(282240) gamma-aminobutyric acid (GABA) A receptor, gamma 2
domestic cat(100286791) gamma-aminobutyric acid (GABA) A receptor, gamma 2
Horse(100059571) gamma-aminobutyric acid (GABA) A receptor, gamma 2
dog(489141) gamma-aminobutyric acid (GABA) A receptor, gamma 2
sheep(101118526) gamma-aminobutyric acid (GABA) A receptor, gamma 2
naked mole-rat(101718598) gamma-aminobutyric acid (GABA) A receptor, gamma 2
domestic guinea pig(100723005) gamma-aminobutyric acid (GABA) A receptor, gamma 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G7795 Ganaxolone solid human, mouse pricing
244309 Ethyl β-carboline-3-carboxylate 97% human, rat pricing
F6300 Flumazenil >99% (HPLC), solid human, rat pricing
A2129 γ-Aminobutyric acid ≥99% human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3539 3-Amino-2,3-dihydrobenzoic acid hydrochloride ≥98% human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
E5126 Etiocholan-3α-ol-17-one human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000816 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083141 MISSION® esiRNA esiRNA human GABRG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000816 Rosetta Predictions human pricing
NM_198903 Rosetta Predictions human pricing
NM_198904 Rosetta Predictions human pricing
NM_183327 Rosetta Predictions rat pricing
NM_008073 Rosetta Predictions mouse pricing
NM_177408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303288 predicted 663
2 SASI_Hs01_00201787 predicted 1818
3 SASI_Hs01_00201790 predicted 1770
4 SASI_Hs01_00201792 predicted 1789
5 SASI_Hs02_00303289 predicted 622
6 SASI_Hs01_00201793 predicted 1813
7 SASI_Hs01_00201794 predicted 1710
8 SASI_Hs02_00303290 predicted 635
9 SASI_Hs01_00201796 predicted 1823
10 SASI_Hs02_00303291 predicted 1810
11 SASI_Hs01_00201788 predicted 1043
12 SASI_Hs01_00201789 predicted 1787
13 SASI_Hs01_00201791 predicted 1027
14 SASI_Hs01_00201795 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372401 predicted 665
2 SASI_Hs01_00034640 predicted 1960
3 SASI_Hs01_00034643 predicted 1914
4 SASI_Hs01_00034645 predicted 1932
5 SASI_Hs02_00372402 predicted 617
6 SASI_Hs01_00034646 predicted 1948
7 SASI_Hs01_00034647 predicted 1863
8 SASI_Hs02_00372403 predicted 636
9 SASI_Hs01_00034649 predicted 1969
10 SASI_Hs02_00372404 predicted 1958
11 SASI_Hs01_00034641 predicted 984
12 SASI_Hs01_00034642 predicted 1717
13 SASI_Hs01_00034644 predicted 965
14 SASI_Hs01_00034648 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372405 predicted 661
2 SASI_Hs01_00198579 predicted 1842
3 SASI_Hs01_00198582 predicted 1796
4 SASI_Hs01_00198584 predicted 1806
5 SASI_Hs02_00372406 predicted 616
6 SASI_Hs01_00198585 predicted 1835
7 SASI_Hs01_00198586 predicted 1739
8 SASI_Hs02_00372407 predicted 633
9 SASI_Hs01_00198588 predicted 1849
10 SASI_Hs02_00372408 predicted 1831
11 SASI_Hs01_00198580 predicted 1053
12 SASI_Hs01_00198581 predicted 1811
13 SASI_Hs01_00198583 predicted 1025
14 SASI_Hs01_00198587 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112488 predicted 769
2 SASI_Rn02_00269877 predicted 784
3 SASI_Rn01_00112490 predicted 1139
4 SASI_Rn01_00112491 predicted 668
5 SASI_Rn02_00269878 predicted 1007
6 SASI_Rn02_00269879 predicted 633
7 SASI_Rn01_00112492 predicted 621
8 SASI_Rn01_00112494 predicted 986
9 SASI_Rn01_00112495 predicted 611
10 SASI_Rn01_00112496 predicted 752
11 SASI_Rn01_00112487 predicted 731
12 SASI_Rn01_00112489 predicted 953
13 SASI_Rn01_00112493 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313062 predicted 1079
2 SASI_Mm02_00313063 predicted 1793
3 SASI_Mm01_00041788 predicted 1761
4 SASI_Mm01_00041789 predicted 1829
5 SASI_Mm02_00313064 predicted 1133
6 SASI_Mm02_00313065 predicted 1750
7 SASI_Mm02_00313066 predicted 1099
8 SASI_Mm01_00041795 predicted 1736
9 SASI_Mm02_00313067 predicted 1014
10 SASI_Mm02_00313068 predicted 892
11 SASI_Mm01_00041786 predicted 1932
12 SASI_Mm01_00041787 predicted 1881
13 SASI_Mm01_00041790 predicted 1942
14 SASI_Mm01_00041791 predicted 909
15 SASI_Mm01_00041792 predicted 1882
16 SASI_Mm01_00041793 predicted 916
17 SASI_Mm01_00041794 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347608 predicted 716
2 SASI_Mm02_00347609 predicted 1414
3 SASI_Mm01_00123064 predicted 1378
4 SASI_Mm01_00123065 predicted 1442
5 SASI_Mm02_00347610 predicted 768
6 SASI_Mm02_00347611 predicted 1363
7 SASI_Mm02_00347612 predicted 737
8 SASI_Mm01_00123071 predicted 1354
9 SASI_Mm02_00347613 predicted 651
10 SASI_Mm02_00347614 predicted 533
11 SASI_Mm01_00123062 predicted 1550
12 SASI_Mm01_00123063 predicted 1503
13 SASI_Mm01_00123066 predicted 1553
14 SASI_Mm01_00123067 predicted 557
15 SASI_Mm01_00123068 predicted 1503
16 SASI_Mm01_00123069 predicted 562
17 SASI_Mm01_00123070 predicted 1514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000816
GABRG2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-2080s21c1
Sequence:CCGGGTATCCTTACTAGATTCATAACTCGAGTTATGAATCTAGTAAGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-1645s21c1
Sequence:CCGGGAGACATGGGAGGATACATATCTCGAGATATGTATCCTCCCATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-1877s21c1
Sequence:CCGGCTATGTCCAAACCTGGTAAATCTCGAGATTTACCAGGTTTGGACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-614s21c1
Sequence:CCGGGGAGTGAAGCCAACGTTAATTCTCGAGAATTAACGTTGGCTTCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1650s1c1
Sequence:CCGGGCCTGTTTAATCTGGTCTATTCTCGAGAATAGACCAGATTAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1137s1c1
Sequence:CCGGGCACACTCATTGTCGTCCTATCTCGAGATAGGACGACAATGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1032s1c1
Sequence:CCGGCCACCGAAGTAGTGAAGACAACTCGAGTTGTCTTCACTACTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-691s1c1
Sequence:CCGGCCTCCGATTGAACAGCAACATCTCGAGATGTTGCTGTTCAATCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000816
GABRG2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-2080s21c1
Sequence:CCGGGTATCCTTACTAGATTCATAACTCGAGTTATGAATCTAGTAAGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-1645s21c1
Sequence:CCGGGAGACATGGGAGGATACATATCTCGAGATATGTATCCTCCCATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-1877s21c1
Sequence:CCGGCTATGTCCAAACCTGGTAAATCTCGAGATTTACCAGGTTTGGACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-614s21c1
Sequence:CCGGGGAGTGAAGCCAACGTTAATTCTCGAGAATTAACGTTGGCTTCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1650s1c1
Sequence:CCGGGCCTGTTTAATCTGGTCTATTCTCGAGAATAGACCAGATTAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1137s1c1
Sequence:CCGGGCACACTCATTGTCGTCCTATCTCGAGATAGGACGACAATGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1032s1c1
Sequence:CCGGCCACCGAAGTAGTGAAGACAACTCGAGTTGTCTTCACTACTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-691s1c1
Sequence:CCGGCCTCCGATTGAACAGCAACATCTCGAGATGTTGCTGTTCAATCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000816
GABRG2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-2080s21c1
Sequence:CCGGGTATCCTTACTAGATTCATAACTCGAGTTATGAATCTAGTAAGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-1645s21c1
Sequence:CCGGGAGACATGGGAGGATACATATCTCGAGATATGTATCCTCCCATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-1877s21c1
Sequence:CCGGCTATGTCCAAACCTGGTAAATCTCGAGATTTACCAGGTTTGGACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-614s21c1
Sequence:CCGGGGAGTGAAGCCAACGTTAATTCTCGAGAATTAACGTTGGCTTCACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1650s1c1
Sequence:CCGGGCCTGTTTAATCTGGTCTATTCTCGAGAATAGACCAGATTAAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1137s1c1
Sequence:CCGGGCACACTCATTGTCGTCCTATCTCGAGATAGGACGACAATGAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1032s1c1
Sequence:CCGGCCACCGAAGTAGTGAAGACAACTCGAGTTGTCTTCACTACTTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-691s1c1
Sequence:CCGGCCTCCGATTGAACAGCAACATCTCGAGATGTTGCTGTTCAATCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008073
GABRG2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-984s1c1
Sequence:CCGGCCTCGTGAAGAAATTGTTTATCTCGAGATAAACAATTTCTTCACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1520s1c1
Sequence:CCGGCAGATCAGCAACCATTCAAATCTCGAGATTTGAATGGTTGCTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008073.1-1932s1c1
Sequence:CCGGCCGTGGTTATTGTAATTTGAACTCGAGTTCAAATTACAATAACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-479s1c1
Sequence:CCGGCTATGAAGATTACGCTTCTAACTCGAGTTAGAAGCGTAATCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1527s1c1
Sequence:CCGGGCAACCATTCAAATGAACAATCTCGAGATTGTTCATTTGAATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008073
GABRG2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-984s1c1
Sequence:CCGGCCTCGTGAAGAAATTGTTTATCTCGAGATAAACAATTTCTTCACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1520s1c1
Sequence:CCGGCAGATCAGCAACCATTCAAATCTCGAGATTTGAATGGTTGCTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008073.1-1932s1c1
Sequence:CCGGCCGTGGTTATTGTAATTTGAACTCGAGTTCAAATTACAATAACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-479s1c1
Sequence:CCGGCTATGAAGATTACGCTTCTAACTCGAGTTAGAAGCGTAATCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1527s1c1
Sequence:CCGGGCAACCATTCAAATGAACAATCTCGAGATTGTTCATTTGAATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008073
GABRG2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-984s1c1
Sequence:CCGGCCTCGTGAAGAAATTGTTTATCTCGAGATAAACAATTTCTTCACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1520s1c1
Sequence:CCGGCAGATCAGCAACCATTCAAATCTCGAGATTTGAATGGTTGCTGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008073.1-1932s1c1
Sequence:CCGGCCGTGGTTATTGTAATTTGAACTCGAGTTCAAATTACAATAACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-479s1c1
Sequence:CCGGCTATGAAGATTACGCTTCTAACTCGAGTTAGAAGCGTAATCTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1527s1c1
Sequence:CCGGGCAACCATTCAAATGAACAATCTCGAGATTGTTCATTTGAATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)