EMAIL THIS PAGE TO A FRIEND

GABRG3

gamma-aminobutyric acid (GABA) A receptor, gamma 3

UniProtKB ID: Q99928, G3V594, Q9HD46, Q9NYT2
Gene ID:
Human(2567) Summary: This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(14407) gamma-aminobutyric acid (GABA) A receptor, subunit gamma 3
Rat(79211) gamma-aminobutyric acid (GABA) A receptor, gamma 3
domestic guinea pig(100729690) gamma-aminobutyric acid (GABA) A receptor, gamma 3
naked mole-rat(101712623) gamma-aminobutyric acid (GABA) A receptor, gamma 3
sheep(101108521) gamma-aminobutyric acid (GABA) A receptor, gamma 3
Zebrafish(567057) gamma-aminobutyric acid (GABA) A receptor, gamma 3
cow(613670) gamma-aminobutyric acid (GABA) A receptor, gamma 3
domestic cat(101094182) gamma-aminobutyric acid (GABA) A receptor, gamma 3
dog(488685) gamma-aminobutyric acid (GABA) A receptor, gamma 3
chicken(770097) gamma-aminobutyric acid (GABA) A receptor, gamma 3
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3539 3-Amino-2,3-dihydrobenzoic acid hydrochloride ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033223 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023001 MISSION® esiRNA esiRNA human GABRG3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033223 Rosetta Predictions human pricing
NM_024370 Rosetta Predictions rat pricing
NM_008074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144147 predicted 404
2 SASI_Hs01_00144148 predicted 1171
3 SASI_Hs01_00144149 predicted 802
4 SASI_Hs01_00144150 predicted 1010
5 SASI_Hs01_00144152 predicted 949
6 SASI_Hs02_00361020 predicted 1215
7 SASI_Hs01_00144153 predicted 601
8 SASI_Hs01_00144154 predicted 467
9 SASI_Hs02_00361021 predicted 1282
10 SASI_Hs02_00361022 predicted 320
11 SASI_Hs01_00144151 predicted 1227
12 SASI_Hs01_00144155 predicted 1301
13 SASI_Hs01_00144156 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087306 predicted 248
2 SASI_Rn01_00087307 predicted 470
3 SASI_Rn01_00087308 predicted 675
4 SASI_Rn01_00087309 predicted 814
5 SASI_Rn01_00087310 predicted 377
6 SASI_Rn01_00087311 predicted 754
7 SASI_Rn01_00087312 predicted 962
8 SASI_Rn01_00087313 predicted 438
9 SASI_Rn01_00087314 predicted 336
10 SASI_Rn01_00087315 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168653 predicted 1198
2 SASI_Mm01_00168655 predicted 1274
3 SASI_Mm01_00168656 predicted 732
4 SASI_Mm01_00168657 predicted 947
5 SASI_Mm01_00168658 predicted 1285
6 SASI_Mm01_00168659 predicted 456
7 SASI_Mm01_00168660 predicted 1104
8 SASI_Mm02_00313069 predicted 407
9 SASI_Mm01_00168661 predicted 314
10 SASI_Mm02_00313070 predicted 582
11 SASI_Mm01_00168652 predicted 1148
12 SASI_Mm01_00168654 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008074
GABRG3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008074.1-1441s1c1
Sequence:CCGGCTGAGGGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1110s1c1
Sequence:CCGGCAAGATGGATTCCTGATCGAACTCGAGTTCGATCAGGAATCCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1399s1c1
Sequence:CCGGCCTGGTCTATTGGGTTGGATACTCGAGTATCCAACCCAATAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-676s1c1
Sequence:CCGGGCGGCTCTATCAGTTTGACTTCTCGAGAAGTCAAACTGATAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1134s1c1
Sequence:CCGGGCCTTCAAGCACCCTCTAATTCTCGAGAATTAGAGGGTGCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008074
GABRG3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008074.1-1441s1c1
Sequence:CCGGCTGAGGGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1110s1c1
Sequence:CCGGCAAGATGGATTCCTGATCGAACTCGAGTTCGATCAGGAATCCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1399s1c1
Sequence:CCGGCCTGGTCTATTGGGTTGGATACTCGAGTATCCAACCCAATAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-676s1c1
Sequence:CCGGGCGGCTCTATCAGTTTGACTTCTCGAGAAGTCAAACTGATAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1134s1c1
Sequence:CCGGGCCTTCAAGCACCCTCTAATTCTCGAGAATTAGAGGGTGCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008074
GABRG3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008074.1-1441s1c1
Sequence:CCGGCTGAGGGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1110s1c1
Sequence:CCGGCAAGATGGATTCCTGATCGAACTCGAGTTCGATCAGGAATCCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1399s1c1
Sequence:CCGGCCTGGTCTATTGGGTTGGATACTCGAGTATCCAACCCAATAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-676s1c1
Sequence:CCGGGCGGCTCTATCAGTTTGACTTCTCGAGAAGTCAAACTGATAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1134s1c1
Sequence:CCGGGCCTTCAAGCACCCTCTAATTCTCGAGAATTAGAGGGTGCTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033223
GABRG3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-668s1c1
Sequence:CCGGCCAGAAATCATGGCGGCTTTACTCGAGTAAAGCCGCCATGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-170s1c1
Sequence:CCGGCGTGACTCTTATTCTCAACAACTCGAGTTGTTGAGAATAAGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1288s1c1
Sequence:CCGGGCTGCTATGAAGAATGTAAATCTCGAGATTTACATTCTTCATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1125s1c1
Sequence:CCGGCCTGAGCGAATAAGCCTACAACTCGAGTTGTAGGCTTATTCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-350s1c1
Sequence:CCGGCCTTCGATTCAACAGCACAATCTCGAGATTGTGCTGTTGAATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-468s21c1
Sequence:CCGGGTAATTGACGTTGACATTTATCTCGAGATAAATGTCAACGTCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-955s21c1
Sequence:CCGGCAACGTCTGCAGGTGATTATGCTCGAGCATAATCACCTGCAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033223
GABRG3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-668s1c1
Sequence:CCGGCCAGAAATCATGGCGGCTTTACTCGAGTAAAGCCGCCATGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-170s1c1
Sequence:CCGGCGTGACTCTTATTCTCAACAACTCGAGTTGTTGAGAATAAGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1288s1c1
Sequence:CCGGGCTGCTATGAAGAATGTAAATCTCGAGATTTACATTCTTCATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1125s1c1
Sequence:CCGGCCTGAGCGAATAAGCCTACAACTCGAGTTGTAGGCTTATTCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-350s1c1
Sequence:CCGGCCTTCGATTCAACAGCACAATCTCGAGATTGTGCTGTTGAATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-468s21c1
Sequence:CCGGGTAATTGACGTTGACATTTATCTCGAGATAAATGTCAACGTCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-955s21c1
Sequence:CCGGCAACGTCTGCAGGTGATTATGCTCGAGCATAATCACCTGCAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033223
GABRG3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-668s1c1
Sequence:CCGGCCAGAAATCATGGCGGCTTTACTCGAGTAAAGCCGCCATGATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-170s1c1
Sequence:CCGGCGTGACTCTTATTCTCAACAACTCGAGTTGTTGAGAATAAGAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1288s1c1
Sequence:CCGGGCTGCTATGAAGAATGTAAATCTCGAGATTTACATTCTTCATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1125s1c1
Sequence:CCGGCCTGAGCGAATAAGCCTACAACTCGAGTTGTAGGCTTATTCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-350s1c1
Sequence:CCGGCCTTCGATTCAACAGCACAATCTCGAGATTGTGCTGTTGAATCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-468s21c1
Sequence:CCGGGTAATTGACGTTGACATTTATCTCGAGATAAATGTCAACGTCAATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-955s21c1
Sequence:CCGGCAACGTCTGCAGGTGATTATGCTCGAGCATAATCACCTGCAGACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks