EMAIL THIS PAGE TO A FRIEND

GABRQ

gamma-aminobutyric acid (GABA) A receptor, theta

60 Gene Product Result for
Synonyms: THETA
UniProtKB ID: Q9UN88, A6NFN1, Q32MB4, Q9NZK8
Gene ID:
Human(55879) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes the theta subunit of the GABA A receptor. The gene is mapped to chromosome Xq28 in a cluster of genes including those that encode the alpha 3 and epsilon subunits of the GABA A receptor. This gene location is also the candidate region of two different neurologic diseases: early-onset parkinsonism (Waisman syndrome) and X-linked mental retardation (MRX3). [provided by RefSeq, Nov 2009]
Mouse(57249) gamma-aminobutyric acid (GABA) A receptor, subunit theta
Rat(65187) gamma-aminobutyric acid (GABA) A receptor, theta
domestic guinea pig(100729123) gamma-aminobutyric acid (GABA) A receptor, theta
naked mole-rat(101714872) gamma-aminobutyric acid (GABA) A receptor, theta
sheep(101113305) gamma-aminobutyric acid (GABA) A receptor, theta
Domestic Rabbit(100352807) gamma-aminobutyric acid (GABA) A receptor, theta
chicken(396288) gamma-aminobutyric acid (GABA) A receptor, theta
cow(527180) gamma-aminobutyric acid (GABA) receptor, theta
Horse(100063455) gamma-aminobutyric acid (GABA) A receptor, theta
domestic cat(101099698) gamma-aminobutyric acid (GABA) A receptor, theta
dog(492225) gamma-aminobutyric acid (GABA) A receptor, theta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA002063 Anti-GABRQ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV35283 Anti-GABRQ antibody produced in rabbit affinity isolated antibody mouse, human, rat, canine, bovine, rabbit, horse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018558 Rosetta Predictions human pricing
NM_031733 Rosetta Predictions rat pricing
NM_020488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220026 predicted 988
2 SASI_Hs01_00220027 predicted 293
3 SASI_Hs01_00220028 predicted 623
4 SASI_Hs01_00220029 predicted 834
5 SASI_Hs02_00352108 predicted 446
6 SASI_Hs01_00220030 predicted 739
7 SASI_Hs02_00352109 predicted 1129
8 SASI_Hs01_00220031 predicted 1687
9 SASI_Hs01_00220032 predicted 639
10 SASI_Hs01_00220033 predicted 276
11 SASI_Hs01_00220034 predicted 858
12 SASI_Hs01_00220035 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043754 predicted 1230
2 SASI_Rn01_00043755 predicted 947
3 SASI_Rn01_00043756 predicted 1365
4 SASI_Rn02_00265117 predicted 1462
5 SASI_Rn01_00043757 predicted 255
6 SASI_Rn01_00043758 predicted 1473
7 SASI_Rn01_00043760 predicted 1560
8 SASI_Rn01_00043761 predicted 431
9 SASI_Rn01_00043762 predicted 244
10 SASI_Rn01_00043763 predicted 1090
11 SASI_Rn01_00043759 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099178 predicted 1401
2 SASI_Mm01_00099179 predicted 908
3 SASI_Mm01_00099180 predicted 1139
4 SASI_Mm01_00099181 predicted 218
5 SASI_Mm01_00099182 predicted 275
6 SASI_Mm01_00099183 predicted 1311
7 SASI_Mm01_00099184 predicted 1124
8 SASI_Mm01_00099185 predicted 763
9 SASI_Mm01_00099186 predicted 371
10 SASI_Mm01_00099187 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020488
GABRQ MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, theta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-378s1c1
Sequence:CCGGGCTTACTATGAAACCAACCTACTCGAGTAGGTTGGTTTCATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-903s1c1
Sequence:CCGGGCCAGGGTAACTATTGGACTACTCGAGTAGTCCAATAGTTACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-1412s1c1
Sequence:CCGGGCCTGAGTGTACCATTCACTTCTCGAGAAGTGAATGGTACACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-379s1c1
Sequence:CCGGCTTACTATGAAACCAACCTAACTCGAGTTAGGTTGGTTTCATAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-904s1c1
Sequence:CCGGCCAGGGTAACTATTGGACTAACTCGAGTTAGTCCAATAGTTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020488
GABRQ MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, theta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-378s1c1
Sequence:CCGGGCTTACTATGAAACCAACCTACTCGAGTAGGTTGGTTTCATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-903s1c1
Sequence:CCGGGCCAGGGTAACTATTGGACTACTCGAGTAGTCCAATAGTTACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-1412s1c1
Sequence:CCGGGCCTGAGTGTACCATTCACTTCTCGAGAAGTGAATGGTACACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-379s1c1
Sequence:CCGGCTTACTATGAAACCAACCTAACTCGAGTTAGGTTGGTTTCATAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-904s1c1
Sequence:CCGGCCAGGGTAACTATTGGACTAACTCGAGTTAGTCCAATAGTTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020488
GABRQ MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, theta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-378s1c1
Sequence:CCGGGCTTACTATGAAACCAACCTACTCGAGTAGGTTGGTTTCATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-903s1c1
Sequence:CCGGGCCAGGGTAACTATTGGACTACTCGAGTAGTCCAATAGTTACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-1412s1c1
Sequence:CCGGGCCTGAGTGTACCATTCACTTCTCGAGAAGTGAATGGTACACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-379s1c1
Sequence:CCGGCTTACTATGAAACCAACCTAACTCGAGTTAGGTTGGTTTCATAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-904s1c1
Sequence:CCGGCCAGGGTAACTATTGGACTAACTCGAGTTAGTCCAATAGTTACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018558
GABRQ MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, theta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-269s1c1
Sequence:CCGGGCCTGTGAGAATATCTATTTACTCGAGTAAATAGATATTCTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-1648s1c1
Sequence:CCGGGCCTTGCCATTAAGGAGCAATCTCGAGATTGCTCCTTAATGGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-107s1c1
Sequence:CCGGCCCGAAATTCCACTTCGAGTTCTCGAGAACTCGAAGTGGAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-988s1c1
Sequence:CCGGCCTGTATCAAGGCCATTGATACTCGAGTATCAATGGCCTTGATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-856s1c1
Sequence:CCGGCCACTATTACCTCTTGGATATCTCGAGATATCCAAGAGGTAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1407s21c1
Sequence:CCGGAGCTATGGTGTTCGCTTTAATCTCGAGATTAAAGCGAACACCATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1054s21c1
Sequence:CCGGAGTATGTCTACATCAACTATCCTCGAGGATAGTTGATGTAGACATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018558
GABRQ MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, theta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-269s1c1
Sequence:CCGGGCCTGTGAGAATATCTATTTACTCGAGTAAATAGATATTCTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-1648s1c1
Sequence:CCGGGCCTTGCCATTAAGGAGCAATCTCGAGATTGCTCCTTAATGGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-107s1c1
Sequence:CCGGCCCGAAATTCCACTTCGAGTTCTCGAGAACTCGAAGTGGAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-988s1c1
Sequence:CCGGCCTGTATCAAGGCCATTGATACTCGAGTATCAATGGCCTTGATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-856s1c1
Sequence:CCGGCCACTATTACCTCTTGGATATCTCGAGATATCCAAGAGGTAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1407s21c1
Sequence:CCGGAGCTATGGTGTTCGCTTTAATCTCGAGATTAAAGCGAACACCATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1054s21c1
Sequence:CCGGAGTATGTCTACATCAACTATCCTCGAGGATAGTTGATGTAGACATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018558
GABRQ MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, theta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-269s1c1
Sequence:CCGGGCCTGTGAGAATATCTATTTACTCGAGTAAATAGATATTCTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-1648s1c1
Sequence:CCGGGCCTTGCCATTAAGGAGCAATCTCGAGATTGCTCCTTAATGGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-107s1c1
Sequence:CCGGCCCGAAATTCCACTTCGAGTTCTCGAGAACTCGAAGTGGAATTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-988s1c1
Sequence:CCGGCCTGTATCAAGGCCATTGATACTCGAGTATCAATGGCCTTGATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-856s1c1
Sequence:CCGGCCACTATTACCTCTTGGATATCTCGAGATATCCAAGAGGTAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1407s21c1
Sequence:CCGGAGCTATGGTGTTCGCTTTAATCTCGAGATTAAAGCGAACACCATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1054s21c1
Sequence:CCGGAGTATGTCTACATCAACTATCCTCGAGGATAGTTGATGTAGACATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks