EMAIL THIS PAGE TO A FRIEND

GABRR1

gamma-aminobutyric acid (GABA) A receptor, rho 1

55 Gene Product Result for
UniProtKB ID: P24046, A1L401, B4DJK8, B4DQT5, B7ZBQ7, Q9BX06
Gene ID:
Human(2569) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. GABRR1 is a member of the rho subunit family. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(14408) gamma-aminobutyric acid (GABA) C receptor, subunit rho 1
Rat(29694) gamma-aminobutyric acid (GABA) A receptor, rho 1
Zebrafish(568984) gamma-aminobutyric acid (GABA) receptor, rho 1
cow(521180) gamma-aminobutyric acid (GABA) A receptor, rho 1
Horse(100070984) gamma-aminobutyric acid (GABA) A receptor, rho 1
domestic cat(101093186) gamma-aminobutyric acid (GABA) A receptor, rho 1
dog(481917) gamma-aminobutyric acid (GABA) A receptor, rho 1
chicken(428632) gamma-aminobutyric acid (GABA) receptor, rho 1
sheep(101114365) gamma-aminobutyric acid (GABA) A receptor, rho 1
naked mole-rat(101724728) gamma-aminobutyric acid (GABA) A receptor, rho 1
domestic guinea pig(100734705) gamma-aminobutyric acid (GABA) A receptor, rho 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100882 Anti-GABRR1 antibody produced in rabbit affinity isolated antibody human, rabbit, canine, guinea pig, horse, mouse, rat, bovine
western blot pricing
SAB4300734 Anti-GABRR1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB2105221 Anti-GABRR1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002042 Rosetta Predictions human pricing
NM_017291 Rosetta Predictions rat pricing
NM_008075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166184 predicted 1265
2 SASI_Hs01_00166185 predicted 573
3 SASI_Hs01_00166186 predicted 635
4 SASI_Hs01_00166187 predicted 282
5 SASI_Hs02_00333076 predicted 218
6 SASI_Hs01_00166188 predicted 637
7 SASI_Hs01_00166190 predicted 255
8 SASI_Hs01_00166191 predicted 213
9 SASI_Hs01_00166192 predicted 1243
10 SASI_Hs01_00166193 predicted 732
11 SASI_Hs01_00166189 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050536 predicted 682
2 SASI_Rn01_00050537 predicted 1608
3 SASI_Rn01_00050538 predicted 1457
4 SASI_Rn01_00050539 predicted 1435
5 SASI_Rn01_00050540 predicted 295
6 SASI_Rn01_00050541 predicted 1614
7 SASI_Rn01_00050542 predicted 669
8 SASI_Rn02_00261730 predicted 1360
9 SASI_Rn01_00050543 predicted 1566
10 SASI_Rn01_00050545 predicted 536
11 SASI_Rn01_00050544 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313071 predicted 530
2 SASI_Mm02_00313072 predicted 462
3 SASI_Mm01_00094292 predicted 667
4 SASI_Mm02_00313073 predicted 1241
5 SASI_Mm01_00094294 predicted 734
6 SASI_Mm02_00313074 predicted 795
7 SASI_Mm01_00094297 predicted 652
8 SASI_Mm01_00094301 predicted 529
9 SASI_Mm01_00094300 predicted 331
10 SASI_Mm02_00313075 predicted 563
11 SASI_Mm01_00094293 predicted 1463
12 SASI_Mm01_00094295 predicted 1338
13 SASI_Mm01_00094296 predicted 1353
14 SASI_Mm01_00094298 predicted 1532
15 SASI_Mm01_00094299 predicted 1568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008075
GABRR1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, rho 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008075.2-1453s21c1
Sequence:CCGGACACTCACGCCATTGATAAATCTCGAGATTTATCAATGGCGTGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008075.2-533s21c1
Sequence:CCGGCTTTGATGGCCGACTTGTAAACTCGAGTTTACAAGTCGGCCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-1511s1c1
Sequence:CCGGCAATCTGATATACTGGTCAATCTCGAGATTGACCAGTATATCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-336s1c1
Sequence:CCGGCTGAGGATAGACGACCATGATCTCGAGATCATGGTCGTCTATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-461s1c1
Sequence:CCGGGACGCTATATTTGAGGCACTACTCGAGTAGTGCCTCAAATATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008075.1-1737s1c1
Sequence:CCGGGCCATGATAGTACCTGACATTCTCGAGAATGTCAGGTACTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-932s1c1
Sequence:CCGGGCGTCGTCACATCTTCTTCTTCTCGAGAAGAAGAAGATGTGACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008075
GABRR1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, rho 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008075.2-1453s21c1
Sequence:CCGGACACTCACGCCATTGATAAATCTCGAGATTTATCAATGGCGTGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008075.2-533s21c1
Sequence:CCGGCTTTGATGGCCGACTTGTAAACTCGAGTTTACAAGTCGGCCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-1511s1c1
Sequence:CCGGCAATCTGATATACTGGTCAATCTCGAGATTGACCAGTATATCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-336s1c1
Sequence:CCGGCTGAGGATAGACGACCATGATCTCGAGATCATGGTCGTCTATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-461s1c1
Sequence:CCGGGACGCTATATTTGAGGCACTACTCGAGTAGTGCCTCAAATATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008075.1-1737s1c1
Sequence:CCGGGCCATGATAGTACCTGACATTCTCGAGAATGTCAGGTACTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-932s1c1
Sequence:CCGGGCGTCGTCACATCTTCTTCTTCTCGAGAAGAAGAAGATGTGACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008075
GABRR1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, rho 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008075.2-1453s21c1
Sequence:CCGGACACTCACGCCATTGATAAATCTCGAGATTTATCAATGGCGTGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008075.2-533s21c1
Sequence:CCGGCTTTGATGGCCGACTTGTAAACTCGAGTTTACAAGTCGGCCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-1511s1c1
Sequence:CCGGCAATCTGATATACTGGTCAATCTCGAGATTGACCAGTATATCAGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-336s1c1
Sequence:CCGGCTGAGGATAGACGACCATGATCTCGAGATCATGGTCGTCTATCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-461s1c1
Sequence:CCGGGACGCTATATTTGAGGCACTACTCGAGTAGTGCCTCAAATATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008075.1-1737s1c1
Sequence:CCGGGCCATGATAGTACCTGACATTCTCGAGAATGTCAGGTACTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008075.1-932s1c1
Sequence:CCGGGCGTCGTCACATCTTCTTCTTCTCGAGAAGAAGAAGATGTGACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002042
GABRR1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, rho 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-692s21c1
Sequence:CCGGGAGGATAGATGACCATGATTTCTCGAGAAATCATGGTCATCTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-1807s21c1
Sequence:CCGGACACCCACGCCATTGATAAATCTCGAGATTTATCAATGGCGTGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-1051s21c1
Sequence:CCGGACATGGACTTCAGCCGATTTCCTCGAGGAAATCGGCTGAAGTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002042.3-2072s21c1
Sequence:CCGGGCACTTATTAACCATCTATTGCTCGAGCAATAGATGGTTAATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002042.3-2138s21c1
Sequence:CCGGGCGACTGATGTTAGTTGTTACCTCGAGGTAACAACTAACATCAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-1348s1c1
Sequence:CCGGCAGCTATGTGAGCATGAGAATCTCGAGATTCTCATGCTCACATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-179s1c1
Sequence:CCGGCACAAGCAAGTCAGCCCAATTCTCGAGAATTGGGCTGACTTGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-757s1c1
Sequence:CCGGCCAGTTCCTCATTCAGGAATTCTCGAGAATTCCTGAATGAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-116s1c1
Sequence:CCGGGTCCACGAGATGTCTAAGAAACTCGAGTTTCTTAGACATCTCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-722s1c1
Sequence:CCGGGACTCCTTAAAGACAGATGAACTCGAGTTCATCTGTCTTTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002042
GABRR1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, rho 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-692s21c1
Sequence:CCGGGAGGATAGATGACCATGATTTCTCGAGAAATCATGGTCATCTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-1807s21c1
Sequence:CCGGACACCCACGCCATTGATAAATCTCGAGATTTATCAATGGCGTGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-1051s21c1
Sequence:CCGGACATGGACTTCAGCCGATTTCCTCGAGGAAATCGGCTGAAGTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002042.3-2072s21c1
Sequence:CCGGGCACTTATTAACCATCTATTGCTCGAGCAATAGATGGTTAATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002042.3-2138s21c1
Sequence:CCGGGCGACTGATGTTAGTTGTTACCTCGAGGTAACAACTAACATCAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-1348s1c1
Sequence:CCGGCAGCTATGTGAGCATGAGAATCTCGAGATTCTCATGCTCACATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-179s1c1
Sequence:CCGGCACAAGCAAGTCAGCCCAATTCTCGAGAATTGGGCTGACTTGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-757s1c1
Sequence:CCGGCCAGTTCCTCATTCAGGAATTCTCGAGAATTCCTGAATGAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-116s1c1
Sequence:CCGGGTCCACGAGATGTCTAAGAAACTCGAGTTTCTTAGACATCTCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-722s1c1
Sequence:CCGGGACTCCTTAAAGACAGATGAACTCGAGTTCATCTGTCTTTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002042
GABRR1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, rho 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-692s21c1
Sequence:CCGGGAGGATAGATGACCATGATTTCTCGAGAAATCATGGTCATCTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-1807s21c1
Sequence:CCGGACACCCACGCCATTGATAAATCTCGAGATTTATCAATGGCGTGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002042.3-1051s21c1
Sequence:CCGGACATGGACTTCAGCCGATTTCCTCGAGGAAATCGGCTGAAGTCCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002042.3-2072s21c1
Sequence:CCGGGCACTTATTAACCATCTATTGCTCGAGCAATAGATGGTTAATAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002042.3-2138s21c1
Sequence:CCGGGCGACTGATGTTAGTTGTTACCTCGAGGTAACAACTAACATCAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-1348s1c1
Sequence:CCGGCAGCTATGTGAGCATGAGAATCTCGAGATTCTCATGCTCACATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-179s1c1
Sequence:CCGGCACAAGCAAGTCAGCCCAATTCTCGAGAATTGGGCTGACTTGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-757s1c1
Sequence:CCGGCCAGTTCCTCATTCAGGAATTCTCGAGAATTCCTGAATGAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-116s1c1
Sequence:CCGGGTCCACGAGATGTCTAAGAAACTCGAGTTTCTTAGACATCTCGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002042.2-722s1c1
Sequence:CCGGGACTCCTTAAAGACAGATGAACTCGAGTTCATCTGTCTTTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks