EMAIL THIS PAGE TO A FRIEND

GABRR2

gamma-aminobutyric acid (GABA) A receptor, rho 2

55 Gene Product Result for
UniProtKB ID: P28476, A2BDE4, Q9H153
Gene ID:
Human(2570) Summary: GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA receptor complex. [provided by RefSeq, Jul 2008]
Mouse(14409) gamma-aminobutyric acid (GABA) C receptor, subunit rho 2
Rat(29695) gamma-aminobutyric acid (GABA) A receptor, rho 2
domestic guinea pig(100735541) gamma-aminobutyric acid (GABA) A receptor, rho 2
naked mole-rat(101724024) gamma-aminobutyric acid (GABA) A receptor, rho 2
sheep(101110852) gamma-aminobutyric acid (GABA) A receptor, rho 2
chicken(421815) gamma-aminobutyric acid (GABA) receptor, rho 2
cow(522099) gamma-aminobutyric acid (GABA) receptor, rho 2
domestic cat(101093609) gamma-aminobutyric acid (GABA) A receptor, rho 2
dog(481918) gamma-aminobutyric acid (GABA) A receptor, rho 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014301 MISSION® esiRNA esiRNA targeting human GABRR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002043 Rosetta Predictions human pricing
NM_017292 Rosetta Predictions rat pricing
NM_008076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028046 predicted 1158
2 SASI_Hs01_00028047 predicted 780
3 SASI_Hs01_00028048 predicted 516
4 SASI_Hs02_00333077 predicted 692
5 SASI_Hs01_00028049 predicted 431
6 SASI_Hs01_00028050 predicted 590
7 SASI_Hs02_00333078 predicted 695
8 SASI_Hs01_00028051 predicted 1405
9 SASI_Hs01_00028052 predicted 410
10 SASI_Hs02_00333079 predicted 755
11 SASI_Hs01_00028053 predicted 1273
12 SASI_Hs01_00028054 predicted 735
13 SASI_Hs01_00028055 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087988 predicted 1244
2 SASI_Rn01_00087989 predicted 1531
3 SASI_Rn01_00087990 predicted 307
4 SASI_Rn01_00087991 predicted 481
5 SASI_Rn01_00087992 predicted 1234
6 SASI_Rn01_00087993 predicted 1413
7 SASI_Rn01_00087994 predicted 1485
8 SASI_Rn01_00087996 predicted 252
9 SASI_Rn01_00087997 predicted 773
10 SASI_Rn02_00261731 predicted 1446
11 SASI_Rn01_00087995 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125489 predicted 448
2 SASI_Mm01_00125491 predicted 541
3 SASI_Mm01_00125492 predicted 491
4 SASI_Mm01_00125493 predicted 646
5 SASI_Mm01_00125494 predicted 1458
6 SASI_Mm01_00125495 predicted 1574
7 SASI_Mm01_00125496 predicted 630
8 SASI_Mm01_00125497 predicted 276
9 SASI_Mm02_00313076 predicted 1431
10 SASI_Mm02_00313077 predicted 1418
11 SASI_Mm01_00125490 predicted 1401
12 SASI_Mm01_00125498 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002043
GABRR2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, rho 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-182s1c1
Sequence:CCGGGCCCAAGCCAAGTCACTTATACTCGAGTATAAGTGACTTGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-1400s1c1
Sequence:CCGGCATTGACAAATACTCTAGGTTCTCGAGAACCTAGAGTATTTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-1178s1c1
Sequence:CCGGGTGTGGAATGCTTCACTCAAACTCGAGTTTGAGTGAAGCATTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-679s1c1
Sequence:CCGGCCTATACAGATGAAGATCTAACTCGAGTTAGATCTTCATCTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-492s1c1
Sequence:CCGGGTCTTCTTTGTTCACTCCAAACTCGAGTTTGGAGTGAACAAAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002043.2-363s21c1
Sequence:CCGGGTGGACATGGACTTCACTATGCTCGAGCATAGTGAAGTCCATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002043.2-1178s21c1
Sequence:CCGGCATGTGTGGAATGCTTCATTCCTCGAGGAATGAAGCATTCCACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002043
GABRR2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, rho 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-182s1c1
Sequence:CCGGGCCCAAGCCAAGTCACTTATACTCGAGTATAAGTGACTTGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-1400s1c1
Sequence:CCGGCATTGACAAATACTCTAGGTTCTCGAGAACCTAGAGTATTTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-1178s1c1
Sequence:CCGGGTGTGGAATGCTTCACTCAAACTCGAGTTTGAGTGAAGCATTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-679s1c1
Sequence:CCGGCCTATACAGATGAAGATCTAACTCGAGTTAGATCTTCATCTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-492s1c1
Sequence:CCGGGTCTTCTTTGTTCACTCCAAACTCGAGTTTGGAGTGAACAAAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002043.2-363s21c1
Sequence:CCGGGTGGACATGGACTTCACTATGCTCGAGCATAGTGAAGTCCATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002043.2-1178s21c1
Sequence:CCGGCATGTGTGGAATGCTTCATTCCTCGAGGAATGAAGCATTCCACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002043
GABRR2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, rho 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-182s1c1
Sequence:CCGGGCCCAAGCCAAGTCACTTATACTCGAGTATAAGTGACTTGGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-1400s1c1
Sequence:CCGGCATTGACAAATACTCTAGGTTCTCGAGAACCTAGAGTATTTGTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-1178s1c1
Sequence:CCGGGTGTGGAATGCTTCACTCAAACTCGAGTTTGAGTGAAGCATTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-679s1c1
Sequence:CCGGCCTATACAGATGAAGATCTAACTCGAGTTAGATCTTCATCTGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002043.1-492s1c1
Sequence:CCGGGTCTTCTTTGTTCACTCCAAACTCGAGTTTGGAGTGAACAAAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002043.2-363s21c1
Sequence:CCGGGTGGACATGGACTTCACTATGCTCGAGCATAGTGAAGTCCATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002043.2-1178s21c1
Sequence:CCGGCATGTGTGGAATGCTTCATTCCTCGAGGAATGAAGCATTCCACACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008076
GABRR2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, rho 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008076.2-1695s1c1
Sequence:CCGGTGGTGGATACATGGACCTAATCTCGAGATTAGGTCCATGTATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1465s1c1
Sequence:CCGGCCAGACAACATCGTGGTTCATCTCGAGATGAACCACGATGTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1626s1c1
Sequence:CCGGCCTAATTTATTGGTCAGTGTTCTCGAGAACACTGACCAATAAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1362s1c1
Sequence:CCGGGCTTCATGCAAGGACCATGATCTCGAGATCATGGTCCTTGCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1590s1c1
Sequence:CCGGCAGGTTGATATTTCCTGCCTTCTCGAGAAGGCAGGAAATATCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008076
GABRR2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, rho 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008076.2-1695s1c1
Sequence:CCGGTGGTGGATACATGGACCTAATCTCGAGATTAGGTCCATGTATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1465s1c1
Sequence:CCGGCCAGACAACATCGTGGTTCATCTCGAGATGAACCACGATGTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1626s1c1
Sequence:CCGGCCTAATTTATTGGTCAGTGTTCTCGAGAACACTGACCAATAAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1362s1c1
Sequence:CCGGGCTTCATGCAAGGACCATGATCTCGAGATCATGGTCCTTGCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1590s1c1
Sequence:CCGGCAGGTTGATATTTCCTGCCTTCTCGAGAAGGCAGGAAATATCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008076
GABRR2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, rho 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008076.2-1695s1c1
Sequence:CCGGTGGTGGATACATGGACCTAATCTCGAGATTAGGTCCATGTATCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1465s1c1
Sequence:CCGGCCAGACAACATCGTGGTTCATCTCGAGATGAACCACGATGTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1626s1c1
Sequence:CCGGCCTAATTTATTGGTCAGTGTTCTCGAGAACACTGACCAATAAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1362s1c1
Sequence:CCGGGCTTCATGCAAGGACCATGATCTCGAGATCATGGTCCTTGCATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008076.2-1590s1c1
Sequence:CCGGCAGGTTGATATTTCCTGCCTTCTCGAGAAGGCAGGAAATATCAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks