EMAIL THIS PAGE TO A FRIEND

GABRR3

gamma-aminobutyric acid (GABA) A receptor, rho 3

67 Gene Product Result for
UniProtKB ID: A8MPY1, Q9UIV9
Gene ID:
Human(200959) Summary: The neurotransmitter gamma-aminobutyric acid (GABA) functions in the central nervous system to regulate synaptic transmission of neurons. This gene encodes one of three related subunits, which combine as homo- or hetero-pentamers to form GABA(C) receptors. In humans, some individuals contain a single-base polymorphism (dbSNP rs832032) that is predicted to inactivate the gene product. [provided by RefSeq, Jan 2012]
Mouse(328699) gamma-aminobutyric acid (GABA) receptor, rho 3
Rat(192258) gamma-aminobutyric acid (GABA) A receptor, rho 3
chicken(430981) gamma-aminobutyric acid (GABA) A receptor, rho 3
cow(520166) gamma-aminobutyric acid (GABA) receptor, rho 3
domestic cat(101082769) gamma-aminobutyric acid (GABA) A receptor, rho 3
sheep(101104110) gamma-aminobutyric acid (GABA) A receptor, rho 3
naked mole-rat(101699269) gamma-aminobutyric acid (GABA) A receptor, rho 3
domestic guinea pig(100722225) gamma-aminobutyric acid (GABA) A receptor, rho 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302105 ANTI-GBRR3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_116036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_116036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_116036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105580 Rosetta Predictions human pricing
NM_138897 Rosetta Predictions rat pricing
NM_001081190 Rosetta Predictions mouse pricing
XM_285181 Rosetta Predictions mouse pricing
XM_902190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324601 predicted 713
2 SASI_Hs02_00324602 predicted 1166
3 SASI_Hs02_00324603 predicted 504
4 SASI_Hs02_00324604 predicted 638
5 SASI_Hs02_00324605 predicted 271
6 SASI_Hs02_00324606 predicted 328
7 SASI_Hs02_00324607 predicted 1095
8 SASI_Hs02_00324608 predicted 292
9 SASI_Hs02_00324609 predicted 687
10 SASI_Hs02_00324610 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041661 predicted 329
2 SASI_Rn02_00268347 predicted 1467
3 SASI_Rn01_00041662 predicted 832
4 SASI_Rn01_00041664 predicted 1018
5 SASI_Rn01_00041665 predicted 797
6 SASI_Rn01_00041666 predicted 656
7 SASI_Rn02_00268348 predicted 1503
8 SASI_Rn01_00041667 predicted 997
9 SASI_Rn01_00041668 predicted 778
10 SASI_Rn02_00268349 predicted 365
11 SASI_Rn01_00041660 predicted 580
12 SASI_Rn01_00041663 predicted 1437
13 SASI_Rn01_00041669 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296071 predicted 247
2 SASI_Mm02_00296072 predicted 464
3 SASI_Mm02_00296073 predicted 522
4 SASI_Mm02_00296074 predicted 416
5 SASI_Mm02_00296075 predicted 1105
6 SASI_Mm02_00296076 predicted 582
7 SASI_Mm02_00296077 predicted 244
8 SASI_Mm02_00296078 predicted 342
9 SASI_Mm02_00296079 predicted 748
10 SASI_Mm02_00296080 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_285181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262351 predicted 327
2 SASI_Mm01_00262352 predicted 245
3 SASI_Mm01_00262353 predicted 232
4 SASI_Mm01_00262354 predicted 248
5 SASI_Mm01_00262355 predicted 383
6 SASI_Mm01_00262356 predicted 265
7 SASI_Mm01_00262357 predicted 388
8 SASI_Mm01_00262358 predicted 301
9 SASI_Mm01_00262359 predicted 237
10 SASI_Mm01_00262360 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215590 predicted 664
2 SASI_Mm01_00215591 predicted 744
3 SASI_Mm01_00215592 predicted 94
4 SASI_Mm01_00215593 predicted 879
5 SASI_Mm01_00215594 predicted 704
6 SASI_Mm01_00215595 predicted 177
7 SASI_Mm01_00215596 predicted 543
8 SASI_Mm01_00215597 predicted 177
9 SASI_Mm01_00215598 predicted 108
10 SASI_Mm01_00215599 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081190
GABRR3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, rho 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-737s21c1
Sequence:CCGGGCAGCACAGGGTGGTACTATACTCGAGTATAGTACCACCCTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-1097s21c1
Sequence:CCGGTATCTGGAATGTACCATATTGCTCGAGCAATATGGTACATTCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-136s21c1
Sequence:CCGGAGGAAAGACGACCTTACTAAACTCGAGTTTAGTAAGGTCGTCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-595s21c1
Sequence:CCGGCTGGAAAGCTATGCCTATAATCTCGAGATTATAGGCATAGCTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-1204s21c1
Sequence:CCGGGAGGACTCCATGAGTACAAAGCTCGAGCTTTGTACTCATGGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081190
GABRR3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, rho 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-737s21c1
Sequence:CCGGGCAGCACAGGGTGGTACTATACTCGAGTATAGTACCACCCTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-1097s21c1
Sequence:CCGGTATCTGGAATGTACCATATTGCTCGAGCAATATGGTACATTCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-136s21c1
Sequence:CCGGAGGAAAGACGACCTTACTAAACTCGAGTTTAGTAAGGTCGTCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-595s21c1
Sequence:CCGGCTGGAAAGCTATGCCTATAATCTCGAGATTATAGGCATAGCTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-1204s21c1
Sequence:CCGGGAGGACTCCATGAGTACAAAGCTCGAGCTTTGTACTCATGGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081190
GABRR3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, rho 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-737s21c1
Sequence:CCGGGCAGCACAGGGTGGTACTATACTCGAGTATAGTACCACCCTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-1097s21c1
Sequence:CCGGTATCTGGAATGTACCATATTGCTCGAGCAATATGGTACATTCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-136s21c1
Sequence:CCGGAGGAAAGACGACCTTACTAAACTCGAGTTTAGTAAGGTCGTCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-595s21c1
Sequence:CCGGCTGGAAAGCTATGCCTATAATCTCGAGATTATAGGCATAGCTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081190.1-1204s21c1
Sequence:CCGGGAGGACTCCATGAGTACAAAGCTCGAGCTTTGTACTCATGGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_116036
GABRR3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, rho 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-1361s1c1
Sequence:CCGGGCACCGATTCATCTCGGATAACTCGAGTTATCCGAGATGAATCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-462s1c1
Sequence:CCGGCCATGATACAACTATGGAGAACTCGAGTTCTCCATAGTTGTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-250s1c1
Sequence:CCGGCCAGTAGGTATAGATGTCCATCTCGAGATGGACATCTATACCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-942s1c1
Sequence:CCGGCCCAGCCATATTGATGGTGATCTCGAGATCACCATCAATATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-718s1c1
Sequence:CCGGGCCTGTGACAAAGCCTACAATCTCGAGATTGTAGGCTTTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_116036
GABRR3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, rho 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-1361s1c1
Sequence:CCGGGCACCGATTCATCTCGGATAACTCGAGTTATCCGAGATGAATCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-462s1c1
Sequence:CCGGCCATGATACAACTATGGAGAACTCGAGTTCTCCATAGTTGTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-250s1c1
Sequence:CCGGCCAGTAGGTATAGATGTCCATCTCGAGATGGACATCTATACCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-942s1c1
Sequence:CCGGCCCAGCCATATTGATGGTGATCTCGAGATCACCATCAATATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-718s1c1
Sequence:CCGGGCCTGTGACAAAGCCTACAATCTCGAGATTGTAGGCTTTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_116036
GABRR3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, rho 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-1361s1c1
Sequence:CCGGGCACCGATTCATCTCGGATAACTCGAGTTATCCGAGATGAATCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-462s1c1
Sequence:CCGGCCATGATACAACTATGGAGAACTCGAGTTCTCCATAGTTGTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-250s1c1
Sequence:CCGGCCAGTAGGTATAGATGTCCATCTCGAGATGGACATCTATACCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-942s1c1
Sequence:CCGGCCCAGCCATATTGATGGTGATCTCGAGATCACCATCAATATGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116036.5-718s1c1
Sequence:CCGGGCCTGTGACAAAGCCTACAATCTCGAGATTGTAGGCTTTGTCACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks