EMAIL THIS PAGE TO A FRIEND

GAD1

glutamate decarboxylase 1 (brain, 67kDa)

168 Gene Product Result for
Synonyms: CPSQ1 GAD SCP
UniProtKB ID: Q99259, Q53TQ7, Q9BU91, Q9UHH4
Gene ID:
Human(2571) Summary: This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantigen and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Deficiency in this enzyme has been shown to lead to pyridoxine dependency with seizures. Alternative splicing of this gene results in two products, the predominant 67-kD form and a less-frequent 25-kD form. [provided by RefSeq, Jul 2008]
Mouse(14415) glutamate decarboxylase 1
Rat(24379) glutamate decarboxylase 1
fruit fly(38484) Glutamic acid decarboxylase 1
cow(517552) glutamate decarboxylase 1 (brain, 67kDa)
domestic cat(493699) glutamate decarboxylase 1 (brain, 67kDa)
dog(478794) glutamate decarboxylase 1 (brain, 67kDa)
chicken(395743) glutamate decarboxylase 1 (brain, 67kDa)
domestic guinea pig(100271904) glutamate decarboxylase 1
naked mole-rat(101725846) glutamate decarboxylase 1 (brain, 67kDa)
sheep(101117393) glutamate decarboxylase 1 (brain, 67kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500443 Anti-GAD1 (Isoform GAD67) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, mouse, pig, bovine, human
ELISA, western blot pricing
SAB2502009 Anti-GAD1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, rat, pig, human, mouse, canine
ELISA, western blot pricing
SAB4300642 Anti-GAD1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
HPA058412 Anti-GAD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107053 Anti-GAD1 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, human, horse
ELISA, western blot pricing
HPA031949 Anti-GAD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2105927 Anti-GAD1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, horse
western blot pricing
SAB4501074 Anti-GAD1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501075 Anti-GAD1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
WH0002571M2 Monoclonal Anti-GAD1 antibody produced in mouse clone 5E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403849 Monoclonal Anti-GAD1 antibody produced in mouse clone 1D12, ascites fluid human
ELISA, western blot pricing
AMAB91076 Monoclonal Anti-GAD1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2911, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91078 Monoclonal Anti-GAD1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2914, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91079 Monoclonal Anti-GAD1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2919, purified immunoglobulin, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
G5419 Monoclonal Anti-Glutamic Acid Decarboxylase 67 (GAD67) antibody produced in mouse clone K-87, purified antibody mouse, rat, human
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A7762 L-Allylglycine ≥99% (TLC), powder human pricing

ELISA

Product # Description Species Add to Cart
 
RAB1472 Human GAD1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000817 Rosetta Predictions human pricing
NM_013445 Rosetta Predictions human pricing
NM_017007 Rosetta Predictions rat pricing
NM_008077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039945 predicted 788
2 SASI_Hs01_00039946 predicted 606
3 SASI_Hs01_00039947 predicted 688
4 SASI_Hs01_00039948 predicted 634
5 SASI_Hs01_00039949 predicted 823
6 SASI_Hs01_00039950 predicted 621
7 SASI_Hs01_00039951 predicted 565
8 SASI_Hs01_00039952 predicted 588
9 SASI_Hs01_00039953 predicted 639
10 SASI_Hs01_00039954 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097176 predicted 799
2 SASI_Hs01_00097177 predicted 602
3 SASI_Hs01_00097178 predicted 688
4 SASI_Hs01_00097179 predicted 635
5 SASI_Hs01_00097180 predicted 825
6 SASI_Hs01_00097181 predicted 631
7 SASI_Hs01_00097182 predicted 564
8 SASI_Hs01_00097183 predicted 592
9 SASI_Hs01_00097184 predicted 638
10 SASI_Hs01_00097185 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261164 predicted 1526
2 SASI_Rn01_00077705 predicted 885
3 SASI_Rn01_00077706 predicted 1128
4 SASI_Rn01_00077708 predicted 951
5 SASI_Rn01_00077709 predicted 811
6 SASI_Rn01_00077710 predicted 251
7 SASI_Rn01_00077712 predicted 756
8 SASI_Rn02_00261165 predicted 963
9 SASI_Rn01_00077713 predicted 1355
10 SASI_Rn01_00077714 predicted 1645
11 SASI_Rn01_00077707 predicted 510
12 SASI_Rn01_00077711 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052972 predicted 1585
2 SASI_Mm01_00052974 predicted 2074
3 SASI_Mm01_00052975 predicted 856
4 SASI_Mm01_00052976 predicted 931
5 SASI_Mm02_00313078 predicted 2106
6 SASI_Mm01_00052977 predicted 810
7 SASI_Mm01_00052978 predicted 998
8 SASI_Mm01_00052979 predicted 1384
9 SASI_Mm01_00052980 predicted 1396
10 SASI_Mm01_00052981 predicted 552
11 SASI_Mm01_00052973 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008077
GAD1 MISSION shRNA Bacterial Glycerol Stock
glutamate decarboxylase 1 (brain, 67kDa)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008077.2-1968s1c1
Sequence:CCGGCCCTCTTTACAGAACCAGAATCTCGAGATTCTGGTTCTGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-1236s1c1
Sequence:CCGGCATTCGATCCAATCCAGGAAACTCGAGTTTCCTGGATTGGATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-1235s1c1
Sequence:CCGGGCATTCGATCCAATCCAGGAACTCGAGTTCCTGGATTGGATCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-255s1c1
Sequence:CCGGGCCCTACAACGTATGATACTTCTCGAGAAGTATCATACGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-542s1c1
Sequence:CCGGGTAGACATACTCCTCAACTATCTCGAGATAGTTGAGGAGTATGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008077
GAD1 MISSION shRNA shRNA Plasmid DNA
glutamate decarboxylase 1 (brain, 67kDa)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008077.2-1968s1c1
Sequence:CCGGCCCTCTTTACAGAACCAGAATCTCGAGATTCTGGTTCTGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-1236s1c1
Sequence:CCGGCATTCGATCCAATCCAGGAAACTCGAGTTTCCTGGATTGGATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-1235s1c1
Sequence:CCGGGCATTCGATCCAATCCAGGAACTCGAGTTCCTGGATTGGATCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-255s1c1
Sequence:CCGGGCCCTACAACGTATGATACTTCTCGAGAAGTATCATACGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-542s1c1
Sequence:CCGGGTAGACATACTCCTCAACTATCTCGAGATAGTTGAGGAGTATGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008077
GAD1 MISSION shRNA Lentiviral Transduction Particles
glutamate decarboxylase 1 (brain, 67kDa)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008077.2-1968s1c1
Sequence:CCGGCCCTCTTTACAGAACCAGAATCTCGAGATTCTGGTTCTGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-1236s1c1
Sequence:CCGGCATTCGATCCAATCCAGGAAACTCGAGTTTCCTGGATTGGATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-1235s1c1
Sequence:CCGGGCATTCGATCCAATCCAGGAACTCGAGTTCCTGGATTGGATCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-255s1c1
Sequence:CCGGGCCCTACAACGTATGATACTTCTCGAGAAGTATCATACGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008077.2-542s1c1
Sequence:CCGGGTAGACATACTCCTCAACTATCTCGAGATAGTTGAGGAGTATGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000817
GAD1 MISSION shRNA Bacterial Glycerol Stock
glutamate decarboxylase 1 (brain, 67kDa)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000078468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1709s1c1
Sequence:CCGGCGCCATAAACTCAACGGCATACTCGAGTATGCCGTTGAGTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1120s1c1
Sequence:CCGGGCTCTCCACTGGATTGGATATCTCGAGATATCCAATCCAGTGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1831s1c1
Sequence:CCGGCAACCAGATGTGTGCAGGATACTCGAGTATCCTGCACACATCTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1587s1c1
Sequence:CCGGGCACGACTGTTTATGGAGCTTCTCGAGAAGCTCCATAAACAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000817
GAD1 MISSION shRNA shRNA Plasmid DNA
glutamate decarboxylase 1 (brain, 67kDa)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000078468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1709s1c1
Sequence:CCGGCGCCATAAACTCAACGGCATACTCGAGTATGCCGTTGAGTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1120s1c1
Sequence:CCGGGCTCTCCACTGGATTGGATATCTCGAGATATCCAATCCAGTGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1831s1c1
Sequence:CCGGCAACCAGATGTGTGCAGGATACTCGAGTATCCTGCACACATCTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1587s1c1
Sequence:CCGGGCACGACTGTTTATGGAGCTTCTCGAGAAGCTCCATAAACAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000817
GAD1 MISSION shRNA Lentiviral Transduction Particles
glutamate decarboxylase 1 (brain, 67kDa)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000078468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1709s1c1
Sequence:CCGGCGCCATAAACTCAACGGCATACTCGAGTATGCCGTTGAGTTTATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1120s1c1
Sequence:CCGGGCTCTCCACTGGATTGGATATCTCGAGATATCCAATCCAGTGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1831s1c1
Sequence:CCGGCAACCAGATGTGTGCAGGATACTCGAGTATCCTGCACACATCTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000817.1-1587s1c1
Sequence:CCGGGCACGACTGTTTATGGAGCTTCTCGAGAAGCTCCATAAACAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks