EMAIL THIS PAGE TO A FRIEND

GAD2

glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)

158 Gene Product Result for
Synonyms: GAD65
UniProtKB ID: Q05329, Q9UD87
Gene ID:
Human(2572) Summary: This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
Mouse(14417) glutamic acid decarboxylase 2
Rat(24380) glutamate decarboxylase 2
Zebrafish(550403) glutamate decarboxylase 2
Thale Cress(842908) glutamate decarboxylase 2
chicken(395395) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
domestic cat(101082244) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
cow(512459) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
dog(487107) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
sheep(101106448) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
naked mole-rat(101698166) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
domestic guinea pig(100734029) glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405839 Anti-GAD2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
SAB4300643 Anti-GAD2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
HPA044637 Anti-GAD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2500444 Anti-GAD2/GAD65 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, chimpanzee, rat, canine
ELISA, western blot pricing
G5038 Anti-Glutamic Acid Decarboxylase 65 (5-22) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, pig, rat, mouse, monkey
immunohistochemistry, microarray, western blot pricing
G4913 Anti-Glutamic Acid Decarboxylase 65 (514-530) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat, pig
immunohistochemistry, microarray, western blot pricing
G5163 Anti-Glutamic Acid Decarboxylase 65/67 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution feline, rat, mouse, pig, human
immunohistochemistry, microarray, western blot pricing
AMAB91048 Monoclonal Anti-GAD2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2736, purified immunoglobulin, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB4200232 Monoclonal Anti-GAD65 antibody produced in mouse ~1.0 mg/mL, clone Clone N-GAD65, purified immunoglobulin rat, monkey, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
G1166 Monoclonal Anti-Glutamic Acid Decarboxylase 65 antibody produced in mouse clone GAD-6, purified immunoglobulin, buffered aqueous solution mammals (and some lower vertebrates)
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A7762 L-Allylglycine ≥99% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000818 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000818 Rosetta Predictions human pricing
NM_012563 Rosetta Predictions rat pricing
NM_008078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094408 predicted 661
2 SASI_Hs01_00094409 predicted 1377
3 SASI_Hs01_00094410 predicted 1529
4 SASI_Hs01_00094411 predicted 748
5 SASI_Hs01_00094412 predicted 692
6 SASI_Hs01_00094413 predicted 676
7 SASI_Hs01_00094414 predicted 1696
8 SASI_Hs01_00094415 predicted 888
9 SASI_Hs02_00303292 predicted 1699
10 SASI_Hs01_00094416 predicted 1637
11 SASI_Hs01_00094417 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084148 predicted 1542
2 SASI_Rn01_00084149 predicted 1336
3 SASI_Rn01_00084151 predicted 1632
4 SASI_Rn01_00084152 predicted 1475
5 SASI_Rn01_00084153 predicted 393
6 SASI_Rn01_00084154 predicted 1667
7 SASI_Rn01_00084155 predicted 1013
8 SASI_Rn01_00084156 predicted 1635
9 SASI_Rn01_00084157 predicted 1179
10 SASI_Rn02_00259674 predicted 641
11 SASI_Rn01_00084150 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313079 predicted 1235
2 SASI_Mm02_00313080 predicted 1441
3 SASI_Mm02_00313081 predicted 2039
4 SASI_Mm02_00313082 predicted 1754
5 SASI_Mm02_00313083 predicted 1599
6 SASI_Mm02_00313084 predicted 1895
7 SASI_Mm02_00313085 predicted 934
8 SASI_Mm02_00313086 predicted 706
9 SASI_Mm02_00313087 predicted 928
10 SASI_Mm02_00313088 predicted 1741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008078
GAD2 MISSION shRNA Bacterial Glycerol Stock
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1114s1c1
Sequence:CCGGCCGCTATAAGATGTCTCCAGACTCGAGTCTGGAGACATCTTATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-730s1c1
Sequence:CCGGCGATAGATCAACTAAAGTGATCTCGAGATCACTTTAGTTGATCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1115s1c1
Sequence:CCGGCGCTATAAGATGTCTCCAGAACTCGAGTTCTGGAGACATCTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008078.1-2337s1c1
Sequence:CCGGGCCTGGTCTACAAAGTGAGTTCTCGAGAACTCACTTTGTAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1941s1c1
Sequence:CCGGCGCCAGTGATTAAAGCCAGAACTCGAGTTCTGGCTTTAATCACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008078
GAD2 MISSION shRNA shRNA Plasmid DNA
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1114s1c1
Sequence:CCGGCCGCTATAAGATGTCTCCAGACTCGAGTCTGGAGACATCTTATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-730s1c1
Sequence:CCGGCGATAGATCAACTAAAGTGATCTCGAGATCACTTTAGTTGATCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1115s1c1
Sequence:CCGGCGCTATAAGATGTCTCCAGAACTCGAGTTCTGGAGACATCTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008078.1-2337s1c1
Sequence:CCGGGCCTGGTCTACAAAGTGAGTTCTCGAGAACTCACTTTGTAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1941s1c1
Sequence:CCGGCGCCAGTGATTAAAGCCAGAACTCGAGTTCTGGCTTTAATCACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008078
GAD2 MISSION shRNA Lentiviral Transduction Particles
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1114s1c1
Sequence:CCGGCCGCTATAAGATGTCTCCAGACTCGAGTCTGGAGACATCTTATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-730s1c1
Sequence:CCGGCGATAGATCAACTAAAGTGATCTCGAGATCACTTTAGTTGATCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1115s1c1
Sequence:CCGGCGCTATAAGATGTCTCCAGAACTCGAGTTCTGGAGACATCTTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008078.1-2337s1c1
Sequence:CCGGGCCTGGTCTACAAAGTGAGTTCTCGAGAACTCACTTTGTAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008078.1-1941s1c1
Sequence:CCGGCGCCAGTGATTAAAGCCAGAACTCGAGTTCTGGCTTTAATCACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000818
GAD2 MISSION shRNA Bacterial Glycerol Stock
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-1102s1c1
Sequence:CCGGGAAGCCAAACAGAAAGGGTTTCTCGAGAAACCCTTTCTGTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-1105s1c1
Sequence:CCGGGCCAAACAGAAAGGGTTTGTTCTCGAGAACAAACCCTTTCTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-904s1c1
Sequence:CCGGCGCTTTAAGATGTTCCCAGAACTCGAGTTCTGGGAACATCTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000818.1-2298s1c1
Sequence:CCGGCCAACATTACTCCATTACTAACTCGAGTTAGTAATGGAGTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-667s1c1
Sequence:CCGGCCTAGATACTTCAATCAACTTCTCGAGAAGTTGATTGAAGTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1543s21c1
Sequence:CCGGTCTTAGCTGTCGCTGACATTTCTCGAGAAATGTCAGCGACAGCTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1393s21c1
Sequence:CCGGACAGCGTGATTCTGATTAAATCTCGAGATTTAATCAGAATCACGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1056s21c1
Sequence:CCGGGGTTTGGATATGGTTGGATTACTCGAGTAATCCAACCATATCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000818.2-2390s21c1
Sequence:CCGGGAACAGACGTTACCAATTATGCTCGAGCATAATTGGTAACGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-986s21c1
Sequence:CCGGGCATTGCCAAACAACTCTAAACTCGAGTTTAGAGTTGTTTGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000818.2-2528s21c1
Sequence:CCGGACCTCAAACTGGGTATCATTTCTCGAGAAATGATACCCAGTTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1200s21c1
Sequence:CCGGGGCTCTGGCGATGGGATATTTCTCGAGAAATATCCCATCGCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000818
GAD2 MISSION shRNA shRNA Plasmid DNA
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-1102s1c1
Sequence:CCGGGAAGCCAAACAGAAAGGGTTTCTCGAGAAACCCTTTCTGTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-1105s1c1
Sequence:CCGGGCCAAACAGAAAGGGTTTGTTCTCGAGAACAAACCCTTTCTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-904s1c1
Sequence:CCGGCGCTTTAAGATGTTCCCAGAACTCGAGTTCTGGGAACATCTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000818.1-2298s1c1
Sequence:CCGGCCAACATTACTCCATTACTAACTCGAGTTAGTAATGGAGTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-667s1c1
Sequence:CCGGCCTAGATACTTCAATCAACTTCTCGAGAAGTTGATTGAAGTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1543s21c1
Sequence:CCGGTCTTAGCTGTCGCTGACATTTCTCGAGAAATGTCAGCGACAGCTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1393s21c1
Sequence:CCGGACAGCGTGATTCTGATTAAATCTCGAGATTTAATCAGAATCACGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1056s21c1
Sequence:CCGGGGTTTGGATATGGTTGGATTACTCGAGTAATCCAACCATATCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000818.2-2390s21c1
Sequence:CCGGGAACAGACGTTACCAATTATGCTCGAGCATAATTGGTAACGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-986s21c1
Sequence:CCGGGCATTGCCAAACAACTCTAAACTCGAGTTTAGAGTTGTTTGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000818.2-2528s21c1
Sequence:CCGGACCTCAAACTGGGTATCATTTCTCGAGAAATGATACCCAGTTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1200s21c1
Sequence:CCGGGGCTCTGGCGATGGGATATTTCTCGAGAAATATCCCATCGCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000818
GAD2 MISSION shRNA Lentiviral Transduction Particles
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-1102s1c1
Sequence:CCGGGAAGCCAAACAGAAAGGGTTTCTCGAGAAACCCTTTCTGTTTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-1105s1c1
Sequence:CCGGGCCAAACAGAAAGGGTTTGTTCTCGAGAACAAACCCTTTCTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-904s1c1
Sequence:CCGGCGCTTTAAGATGTTCCCAGAACTCGAGTTCTGGGAACATCTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000818.1-2298s1c1
Sequence:CCGGCCAACATTACTCCATTACTAACTCGAGTTAGTAATGGAGTAATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000818.1-667s1c1
Sequence:CCGGCCTAGATACTTCAATCAACTTCTCGAGAAGTTGATTGAAGTATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1543s21c1
Sequence:CCGGTCTTAGCTGTCGCTGACATTTCTCGAGAAATGTCAGCGACAGCTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1393s21c1
Sequence:CCGGACAGCGTGATTCTGATTAAATCTCGAGATTTAATCAGAATCACGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1056s21c1
Sequence:CCGGGGTTTGGATATGGTTGGATTACTCGAGTAATCCAACCATATCCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000818.2-2390s21c1
Sequence:CCGGGAACAGACGTTACCAATTATGCTCGAGCATAATTGGTAACGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-986s21c1
Sequence:CCGGGCATTGCCAAACAACTCTAAACTCGAGTTTAGAGTTGTTTGGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000818.2-2528s21c1
Sequence:CCGGACCTCAAACTGGGTATCATTTCTCGAGAAATGATACCCAGTTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000818.2-1200s21c1
Sequence:CCGGGGCTCTGGCGATGGGATATTTCTCGAGAAATATCCCATCGCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks