EMAIL THIS PAGE TO A FRIEND

GADD45A

growth arrest and DNA-damage-inducible, alpha

Synonyms: DDIT1 GADD45
UniProtKB ID: P24522, Q5TCA7, Q5TCA8
Gene ID:
Human(1647) Summary: This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The DNA damage-induced transcription of this gene is mediated by both p53-dependent and -independent mechanisms. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Dec 2010]
Mouse(13197) growth arrest and DNA-damage-inducible 45 alpha
Rat(25112) growth arrest and DNA-damage-inducible, alpha
chicken(693255) growth arrest and DNA-damage-inducible, alpha
cow(505463) growth arrest and DNA-damage-inducible, alpha
domestic guinea pig(100719739) growth arrest and DNA-damage-inducible, alpha
naked mole-rat(101725746) growth arrest and DNA-damage-inducible, alpha
sheep(101115240) growth arrest and DNA-damage-inducible, alpha
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001924 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051621 MISSION® esiRNA esiRNA human GADD45A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001924 Rosetta Predictions human pricing
NM_024127 Rosetta Predictions rat pricing
NM_007836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030949 predicted 385
2 SASI_Hs02_00332817 predicted 1032
3 SASI_Hs01_00030951 predicted 868
4 SASI_Hs01_00030952 predicted 960
5 SASI_Hs01_00030953 predicted 1123
6 SASI_Hs01_00030954 predicted 854
7 SASI_Hs01_00030955 predicted 697
8 SASI_Hs01_00030956 predicted 700
9 SASI_Hs01_00030957 predicted 812
10 SASI_Hs01_00030958 predicted 494
11 SASI_Hs01_00030950 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263846 predicted 259
2 SASI_Rn01_00117416 predicted 374
3 SASI_Rn01_00117417 predicted 253
4 SASI_Rn01_00117418 predicted 550
5 SASI_Rn01_00117420 predicted 651
6 SASI_Rn01_00117421 predicted 521
7 SASI_Rn01_00117422 predicted 554
8 SASI_Rn01_00117423 predicted 684
9 SASI_Rn01_00117424 predicted 666
10 SASI_Rn02_00263847 predicted 743
11 SASI_Rn01_00117415 predicted 282
12 SASI_Rn01_00117419 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201808 predicted 260
2 SASI_Mm01_00201809 predicted 745
3 SASI_Mm01_00201811 predicted 569
4 SASI_Mm02_00312577 predicted 356
5 SASI_Mm01_00201812 predicted 542
6 SASI_Mm01_00201813 predicted 686
7 SASI_Mm01_00201814 predicted 548
8 SASI_Mm01_00201815 predicted 577
9 SASI_Mm01_00201816 predicted 664
10 SASI_Mm01_00201817 predicted 635
11 SASI_Mm01_00201810 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007836
VALIDATED
GADD45A MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, alpha
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-550s21c1
Sequence:CCGGCCCACATTCATCACAATGGAACTCGAGTTCCATTGTGATGAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-407s21c1
Sequence:CCGGTGCTGCGAGAACGACATCAACCTCGAGGTTGATGTCGTTCTCGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007836.1-925s21c1
Sequence:CCGGTAGGATGGCCAGGTTACTTTCCTCGAGGAAAGTAACCTGGCCATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-661s21c1
Sequence:CCGGATGGCATCCGAATGGAAATAACTCGAGTTATTTCCATTCGGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007836.1-376s1c1
Sequence:CCGGGCAGATCCATTTCACCCTCATCTCGAGATGAGGGTGAAATGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007836.1-575s1c1
Sequence:CCGGCCTGCCTTAAGTCAACTTATTCTCGAGAATAAGTTGACTTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007836.1-251s1c1
Sequence:CCGGGCTCGGAGTCAGCGCACCATTCTCGAGAATGGTGCGCTGACTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007836.1-635s1c1
Sequence:CCGGCCCGTGATTAATCTCCCGGAACTCGAGTTCCGGGAGATTAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007836
VALIDATED
GADD45A MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, alpha
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-550s21c1
Sequence:CCGGCCCACATTCATCACAATGGAACTCGAGTTCCATTGTGATGAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-407s21c1
Sequence:CCGGTGCTGCGAGAACGACATCAACCTCGAGGTTGATGTCGTTCTCGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007836.1-925s21c1
Sequence:CCGGTAGGATGGCCAGGTTACTTTCCTCGAGGAAAGTAACCTGGCCATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-661s21c1
Sequence:CCGGATGGCATCCGAATGGAAATAACTCGAGTTATTTCCATTCGGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007836.1-376s1c1
Sequence:CCGGGCAGATCCATTTCACCCTCATCTCGAGATGAGGGTGAAATGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007836.1-575s1c1
Sequence:CCGGCCTGCCTTAAGTCAACTTATTCTCGAGAATAAGTTGACTTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007836.1-251s1c1
Sequence:CCGGGCTCGGAGTCAGCGCACCATTCTCGAGAATGGTGCGCTGACTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007836.1-635s1c1
Sequence:CCGGCCCGTGATTAATCTCCCGGAACTCGAGTTCCGGGAGATTAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007836
VALIDATED
GADD45A MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, alpha
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-550s21c1
Sequence:CCGGCCCACATTCATCACAATGGAACTCGAGTTCCATTGTGATGAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-407s21c1
Sequence:CCGGTGCTGCGAGAACGACATCAACCTCGAGGTTGATGTCGTTCTCGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007836.1-925s21c1
Sequence:CCGGTAGGATGGCCAGGTTACTTTCCTCGAGGAAAGTAACCTGGCCATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007836.1-661s21c1
Sequence:CCGGATGGCATCCGAATGGAAATAACTCGAGTTATTTCCATTCGGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007836.1-376s1c1
Sequence:CCGGGCAGATCCATTTCACCCTCATCTCGAGATGAGGGTGAAATGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007836.1-575s1c1
Sequence:CCGGCCTGCCTTAAGTCAACTTATTCTCGAGAATAAGTTGACTTAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007836.1-251s1c1
Sequence:CCGGGCTCGGAGTCAGCGCACCATTCTCGAGAATGGTGCGCTGACTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007836.1-635s1c1
Sequence:CCGGCCCGTGATTAATCTCCCGGAACTCGAGTTCCGGGAGATTAATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001924
VALIDATED
GADD45A MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-733s21c1
Sequence:CCGGTTGCCGGGAAAGTCGCTACATCTCGAGATGTAGCGACTTTCCCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-758s21c1
Sequence:GTACCGGCAATGGGTTCCAGTGATTAATCTCGAGATTAATCACTGGAACCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-706s21c1
Sequence:GTACCGGTCCTGCCTTAAGTCAACTTATCTCGAGATAAGTTGACTTAAGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001924.2-1177s21c1
Sequence:CCGGAGCCGAAAGGGTTAATCATATCTCGAGATATGATTAACCCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-328s21c1
Sequence:CCGGGAAGACCGAAAGGATGGATAACTCGAGTTATCCATCCTTTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-678s1c1
Sequence:CCGGCGAATCCACATTCATCTCAATCTCGAGATTGAGATGAATGTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001924.2-328s1c1
Sequence:CCGGGAAGACCGAAAGGATGGATAACTCGAGTTATCCATCCTTTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-767s1c1
Sequence:CCGGCCAGTGATTAATCTCCCTGAACTCGAGTTCAGGGAGATTAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-746s1c1
Sequence:CCGGCGCTACATGGATCAATGGGTTCTCGAGAACCCATTGATCCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-322s1c1
Sequence:CCGGAGAGCAGAAGACCGAAAGGATCTCGAGATCCTTTCGGTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001924
VALIDATED
GADD45A MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-733s21c1
Sequence:CCGGTTGCCGGGAAAGTCGCTACATCTCGAGATGTAGCGACTTTCCCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-758s21c1
Sequence:GTACCGGCAATGGGTTCCAGTGATTAATCTCGAGATTAATCACTGGAACCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-706s21c1
Sequence:GTACCGGTCCTGCCTTAAGTCAACTTATCTCGAGATAAGTTGACTTAAGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001924.2-1177s21c1
Sequence:CCGGAGCCGAAAGGGTTAATCATATCTCGAGATATGATTAACCCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-328s21c1
Sequence:CCGGGAAGACCGAAAGGATGGATAACTCGAGTTATCCATCCTTTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-678s1c1
Sequence:CCGGCGAATCCACATTCATCTCAATCTCGAGATTGAGATGAATGTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001924.2-328s1c1
Sequence:CCGGGAAGACCGAAAGGATGGATAACTCGAGTTATCCATCCTTTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-767s1c1
Sequence:CCGGCCAGTGATTAATCTCCCTGAACTCGAGTTCAGGGAGATTAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-746s1c1
Sequence:CCGGCGCTACATGGATCAATGGGTTCTCGAGAACCCATTGATCCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-322s1c1
Sequence:CCGGAGAGCAGAAGACCGAAAGGATCTCGAGATCCTTTCGGTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001924
VALIDATED
GADD45A MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-733s21c1
Sequence:CCGGTTGCCGGGAAAGTCGCTACATCTCGAGATGTAGCGACTTTCCCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-758s21c1
Sequence:GTACCGGCAATGGGTTCCAGTGATTAATCTCGAGATTAATCACTGGAACCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-706s21c1
Sequence:GTACCGGTCCTGCCTTAAGTCAACTTATCTCGAGATAAGTTGACTTAAGGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001924.2-1177s21c1
Sequence:CCGGAGCCGAAAGGGTTAATCATATCTCGAGATATGATTAACCCTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001924.2-328s21c1
Sequence:CCGGGAAGACCGAAAGGATGGATAACTCGAGTTATCCATCCTTTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-678s1c1
Sequence:CCGGCGAATCCACATTCATCTCAATCTCGAGATTGAGATGAATGTGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001924.2-328s1c1
Sequence:CCGGGAAGACCGAAAGGATGGATAACTCGAGTTATCCATCCTTTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-767s1c1
Sequence:CCGGCCAGTGATTAATCTCCCTGAACTCGAGTTCAGGGAGATTAATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-746s1c1
Sequence:CCGGCGCTACATGGATCAATGGGTTCTCGAGAACCCATTGATCCATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001924.2-322s1c1
Sequence:CCGGAGAGCAGAAGACCGAAAGGATCTCGAGATCCTTTCGGTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks