EMAIL THIS PAGE TO A FRIEND

GADD45B

growth arrest and DNA-damage-inducible, beta

51 Gene Product Result for
Synonyms: GADD45BETA MYD118
UniProtKB ID: O75293, A8KAM2, O75960, Q17R46
Gene ID:
Human(4616) Summary: This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The genes in this group respond to environmental stresses by mediating activation of the p38/JNK pathway. This activation is mediated via their proteins binding and activating MTK1/MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. The function of these genes or their protein products is involved in the regulation of growth and apoptosis. These genes are regulated by different mechanisms, but they are often coordinately expressed and can function cooperatively in inhibiting cell growth. [provided by RefSeq, Jul 2008]
Mouse(17873) growth arrest and DNA-damage-inducible 45 beta
Rat(299626) growth arrest and DNA-damage-inducible, beta
chicken(429929) growth arrest and DNA-damage-inducible, beta
domestic cat(101087971) growth arrest and DNA-damage-inducible, beta
cow(618405) growth arrest and DNA-damage-inducible, beta
dog(485069) growth arrest and DNA-damage-inducible, beta
sheep(101120573) growth arrest and DNA-damage-inducible, beta
naked mole-rat(101710909) growth arrest and DNA-damage-inducible, beta
domestic guinea pig(100730773) growth arrest and DNA-damage-inducible, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108614 Anti-GADD45B affinity isolated antibody human, guinea pig, pig, bovine, dog, mouse, rat, zebrafish
immunohistochemistry, western blot pricing
AV48346 Anti-GADD45B antibody produced in rabbit affinity isolated antibody mouse, rat, bovine, horse, guinea pig, canine, human
western blot pricing
HPA029816 Anti-GADD45B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015675 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015675 Rosetta Predictions human pricing
NM_001008321 Rosetta Predictions rat pricing
NM_008655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098526 predicted 238
2 SASI_Hs01_00098527 predicted 250
3 SASI_Hs01_00098528 predicted 1120
4 SASI_Hs01_00098529 predicted 461
5 SASI_Hs01_00098530 predicted 450
6 SASI_Hs01_00098531 predicted 417
7 SASI_Hs01_00098532 predicted 452
8 SASI_Hs02_00348314 predicted 464
9 SASI_Hs01_00098533 predicted 466
10 SASI_Hs01_00098534 predicted 382
11 SASI_Hs01_00098535 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042837 predicted 727
2 SASI_Rn01_00042838 predicted 422
3 SASI_Rn01_00042839 predicted 926
4 SASI_Rn01_00042840 predicted 494
5 SASI_Rn01_00042841 predicted 716
6 SASI_Rn01_00042842 predicted 462
7 SASI_Rn01_00042843 predicted 584
8 SASI_Rn01_00042844 predicted 545
9 SASI_Rn01_00042845 predicted 390
10 SASI_Rn02_00199059 predicted 687
11 SASI_Rn01_00042846 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158349 predicted 453
2 SASI_Mm01_00158350 predicted 916
3 SASI_Mm01_00158351 predicted 682
4 SASI_Mm01_00158352 predicted 847
5 SASI_Mm02_00314409 predicted 449
6 SASI_Mm01_00158353 predicted 712
7 SASI_Mm01_00158354 predicted 467
8 SASI_Mm01_00158355 predicted 245
9 SASI_Mm01_00158356 predicted 435
10 SASI_Mm01_00158357 predicted 687
11 SASI_Mm01_00158358 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015675
VALIDATED
GADD45B MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, beta
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-226s1c1
Sequence:CCGGGTCGGCCAAGTTGATGAATGTCTCGAGACATTCATCAACTTGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015675.1-963s1c1
Sequence:CCGGGTACCCATGAACTCCCAGTTTCTCGAGAAACTGGGAGTTCATGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-564s1c1
Sequence:CCGGACATCTCTCTTCAGGAACGCTCTCGAGAGCGTTCCTGAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-440s1c1
Sequence:CCGGGCCCGAGACCTCCACTGTCTTCTCGAGAAGACAGTGGAGGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015675.1-313s1c1
Sequence:CCGGGCAAATCCACTTCACGCTCATCTCGAGATGAGCGTGAAGTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1110s21c1
Sequence:CCGGGCGTCTGCATACGAGAGACTTCTCGAGAAGTCTCTCGTATGCAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-426s21c1
Sequence:CCGGCATCGCCCTGCAAATCCACTTCTCGAGAAGTGGATTTGCAGGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1160s21c1
Sequence:CCGGCCTCGACAAGACCACACTTTGCTCGAGCAAAGTGTGGTCTTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1168s21c1
Sequence:CCGGAGACCACACTTTGGGACTTGGCTCGAGCCAAGTCCCAAAGTGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-394s21c1
Sequence:CCGGCTCTTGGCCATTGACGAGGAGCTCGAGCTCCTCGTCAATGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-470s21c1
Sequence:CCGGGTGACAACGACATCAACATCGCTCGAGCGATGTTGATGTCGTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-832s21c1
Sequence:CCGGAGAGTCGTTGGAGACTGAAGACTCGAGTCTTCAGTCTCCAACGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1031s21c1
Sequence:CCGGATCACGGAGGGTCCAGACTGTCTCGAGACAGTCTGGACCCTCCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1132s21c1
Sequence:CCGGGTTGAACTTGGTTGGTCCTTGCTCGAGCAAGGACCAACCAAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-339s21c1
Sequence:CCGGGGTGTACGAGTCGGCCAAGTTCTCGAGAACTTGGCCGACTCGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-574s21c1
Sequence:CCGGCATTGTCTCCTGGTCACGAACCTCGAGGTTCGTGACCAGGAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015675
VALIDATED
GADD45B MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, beta
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-226s1c1
Sequence:CCGGGTCGGCCAAGTTGATGAATGTCTCGAGACATTCATCAACTTGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015675.1-963s1c1
Sequence:CCGGGTACCCATGAACTCCCAGTTTCTCGAGAAACTGGGAGTTCATGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-564s1c1
Sequence:CCGGACATCTCTCTTCAGGAACGCTCTCGAGAGCGTTCCTGAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-440s1c1
Sequence:CCGGGCCCGAGACCTCCACTGTCTTCTCGAGAAGACAGTGGAGGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015675.1-313s1c1
Sequence:CCGGGCAAATCCACTTCACGCTCATCTCGAGATGAGCGTGAAGTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1110s21c1
Sequence:CCGGGCGTCTGCATACGAGAGACTTCTCGAGAAGTCTCTCGTATGCAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-426s21c1
Sequence:CCGGCATCGCCCTGCAAATCCACTTCTCGAGAAGTGGATTTGCAGGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1160s21c1
Sequence:CCGGCCTCGACAAGACCACACTTTGCTCGAGCAAAGTGTGGTCTTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1168s21c1
Sequence:CCGGAGACCACACTTTGGGACTTGGCTCGAGCCAAGTCCCAAAGTGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-394s21c1
Sequence:CCGGCTCTTGGCCATTGACGAGGAGCTCGAGCTCCTCGTCAATGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-470s21c1
Sequence:CCGGGTGACAACGACATCAACATCGCTCGAGCGATGTTGATGTCGTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-832s21c1
Sequence:CCGGAGAGTCGTTGGAGACTGAAGACTCGAGTCTTCAGTCTCCAACGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1031s21c1
Sequence:CCGGATCACGGAGGGTCCAGACTGTCTCGAGACAGTCTGGACCCTCCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1132s21c1
Sequence:CCGGGTTGAACTTGGTTGGTCCTTGCTCGAGCAAGGACCAACCAAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-339s21c1
Sequence:CCGGGGTGTACGAGTCGGCCAAGTTCTCGAGAACTTGGCCGACTCGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-574s21c1
Sequence:CCGGCATTGTCTCCTGGTCACGAACCTCGAGGTTCGTGACCAGGAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015675
VALIDATED
GADD45B MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, beta
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-226s1c1
Sequence:CCGGGTCGGCCAAGTTGATGAATGTCTCGAGACATTCATCAACTTGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015675.1-963s1c1
Sequence:CCGGGTACCCATGAACTCCCAGTTTCTCGAGAAACTGGGAGTTCATGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-564s1c1
Sequence:CCGGACATCTCTCTTCAGGAACGCTCTCGAGAGCGTTCCTGAAGAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015675.1-440s1c1
Sequence:CCGGGCCCGAGACCTCCACTGTCTTCTCGAGAAGACAGTGGAGGTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015675.1-313s1c1
Sequence:CCGGGCAAATCCACTTCACGCTCATCTCGAGATGAGCGTGAAGTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1110s21c1
Sequence:CCGGGCGTCTGCATACGAGAGACTTCTCGAGAAGTCTCTCGTATGCAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-426s21c1
Sequence:CCGGCATCGCCCTGCAAATCCACTTCTCGAGAAGTGGATTTGCAGGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1160s21c1
Sequence:CCGGCCTCGACAAGACCACACTTTGCTCGAGCAAAGTGTGGTCTTGTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1168s21c1
Sequence:CCGGAGACCACACTTTGGGACTTGGCTCGAGCCAAGTCCCAAAGTGTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-394s21c1
Sequence:CCGGCTCTTGGCCATTGACGAGGAGCTCGAGCTCCTCGTCAATGGCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-470s21c1
Sequence:CCGGGTGACAACGACATCAACATCGCTCGAGCGATGTTGATGTCGTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-832s21c1
Sequence:CCGGAGAGTCGTTGGAGACTGAAGACTCGAGTCTTCAGTCTCCAACGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1031s21c1
Sequence:CCGGATCACGGAGGGTCCAGACTGTCTCGAGACAGTCTGGACCCTCCGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015675.2-1132s21c1
Sequence:CCGGGTTGAACTTGGTTGGTCCTTGCTCGAGCAAGGACCAACCAAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-339s21c1
Sequence:CCGGGGTGTACGAGTCGGCCAAGTTCTCGAGAACTTGGCCGACTCGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015675.2-574s21c1
Sequence:CCGGCATTGTCTCCTGGTCACGAACCTCGAGGTTCGTGACCAGGAGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008655
VALIDATED
GADD45B MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008655.1-964s1c1
Sequence:CCGGGCAAGAGGAGACTGAGACTTTCTCGAGAAAGTCTCAGTCTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-471s1c1
Sequence:CCGGCTGCGACAATGACATTGACATCTCGAGATGTCAATGTCATTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-682s1c1
Sequence:CCGGCCCTATATCTCTCTAGAGGAACTCGAGTTCCTCTAGAGAGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-459s1c1
Sequence:CCGGCCAGTCGTTCTGCTGCGACAACTCGAGTTGTCGCAGCAGAACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-593s1c1
Sequence:CCGGCGAACTGTCATACAGATTCCTCTCGAGAGGAATCTGTATGACAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-709s21c1
Sequence:CCGGGACCCACTCCAAACATCTAAACTCGAGTTTAGATGTTTGGAGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-651s21c1
Sequence:CCGGTGAAGAGAGCAGAGGCAATAACTCGAGTTATTGCCTCTGCTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-591s21c1
Sequence:CCGGCACGAACTGTCATACAGATTCCTCGAGGAATCTGTATGACAGTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008655.1-461s21c1
Sequence:CCGGAGTCGTTCTGCTGCGACAATGCTCGAGCATTGTCGCAGCAGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008655.1-425s21c1
Sequence:CCGGATGATATCGCTCTGCAGATTCCTCGAGGAATCTGCAGAGCGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008655
VALIDATED
GADD45B MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008655.1-964s1c1
Sequence:CCGGGCAAGAGGAGACTGAGACTTTCTCGAGAAAGTCTCAGTCTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-471s1c1
Sequence:CCGGCTGCGACAATGACATTGACATCTCGAGATGTCAATGTCATTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-682s1c1
Sequence:CCGGCCCTATATCTCTCTAGAGGAACTCGAGTTCCTCTAGAGAGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-459s1c1
Sequence:CCGGCCAGTCGTTCTGCTGCGACAACTCGAGTTGTCGCAGCAGAACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-593s1c1
Sequence:CCGGCGAACTGTCATACAGATTCCTCTCGAGAGGAATCTGTATGACAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-709s21c1
Sequence:CCGGGACCCACTCCAAACATCTAAACTCGAGTTTAGATGTTTGGAGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-651s21c1
Sequence:CCGGTGAAGAGAGCAGAGGCAATAACTCGAGTTATTGCCTCTGCTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-591s21c1
Sequence:CCGGCACGAACTGTCATACAGATTCCTCGAGGAATCTGTATGACAGTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008655.1-461s21c1
Sequence:CCGGAGTCGTTCTGCTGCGACAATGCTCGAGCATTGTCGCAGCAGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008655.1-425s21c1
Sequence:CCGGATGATATCGCTCTGCAGATTCCTCGAGGAATCTGCAGAGCGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008655
VALIDATED
GADD45B MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008655.1-964s1c1
Sequence:CCGGGCAAGAGGAGACTGAGACTTTCTCGAGAAAGTCTCAGTCTCCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-471s1c1
Sequence:CCGGCTGCGACAATGACATTGACATCTCGAGATGTCAATGTCATTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-682s1c1
Sequence:CCGGCCCTATATCTCTCTAGAGGAACTCGAGTTCCTCTAGAGAGATATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-459s1c1
Sequence:CCGGCCAGTCGTTCTGCTGCGACAACTCGAGTTGTCGCAGCAGAACGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008655.1-593s1c1
Sequence:CCGGCGAACTGTCATACAGATTCCTCTCGAGAGGAATCTGTATGACAGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-709s21c1
Sequence:CCGGGACCCACTCCAAACATCTAAACTCGAGTTTAGATGTTTGGAGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-651s21c1
Sequence:CCGGTGAAGAGAGCAGAGGCAATAACTCGAGTTATTGCCTCTGCTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008655.1-591s21c1
Sequence:CCGGCACGAACTGTCATACAGATTCCTCGAGGAATCTGTATGACAGTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008655.1-461s21c1
Sequence:CCGGAGTCGTTCTGCTGCGACAATGCTCGAGCATTGTCGCAGCAGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008655.1-425s21c1
Sequence:CCGGATGATATCGCTCTGCAGATTCCTCGAGGAATCTGCAGAGCGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks