EMAIL THIS PAGE TO A FRIEND

GADD45G

growth arrest and DNA-damage-inducible, gamma

57 Gene Product Result for
Synonyms: CR6 DDIT2 GADD45gamma GRP17
UniProtKB ID: O95257, Q9C076
Gene ID:
Human(10912) Summary: This gene is a member of a group of genes whose transcript levels are increased following stressful growth arrest conditions and treatment with DNA-damaging agents. The protein encoded by this gene responds to environmental stresses by mediating activation of the p38/JNK pathway via MTK1/MEKK4 kinase. The GADD45G is highly expressed in placenta. [provided by RefSeq, Jul 2008]
Mouse(23882) growth arrest and DNA-damage-inducible 45 gamma
Rat(291005) growth arrest and DNA-damage-inducible, gamma
Zebrafish(402991) growth arrest and DNA-damage-inducible, gamma
domestic cat(101086509) growth arrest and DNA-damage-inducible, gamma
cow(504939) growth arrest and DNA-damage-inducible, gamma
dog(484198) growth arrest and DNA-damage-inducible, gamma
sheep(100885762) growth arrest and DNA-damage-inducible, gamma
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004851 MISSION® esiRNA esiRNA targeting human GADD45G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006705 Rosetta Predictions human pricing
NM_001077640 Rosetta Predictions rat pricing
NM_011817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036486 predicted 224
2 SASI_Hs01_00036487 predicted 219
3 SASI_Hs01_00036488 predicted 345
4 SASI_Hs01_00036489 predicted 225
5 SASI_Hs01_00036490 predicted 443
6 SASI_Hs02_00342131 predicted 446
7 SASI_Hs01_00036492 predicted 344
8 SASI_Hs01_00036493 predicted 380
9 SASI_Hs01_00036494 predicted 460
10 SASI_Hs01_00036495 predicted 231
11 SASI_Hs01_00036491 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207632 predicted 209
2 SASI_Rn02_00207633 predicted 783
3 SASI_Rn02_00207634 predicted 229
4 SASI_Rn02_00207635 predicted 487
5 SASI_Rn02_00207636 predicted 443
6 SASI_Rn02_00207637 predicted 275
7 SASI_Rn02_00207638 predicted 578
8 SASI_Rn02_00207639 predicted 336
9 SASI_Rn02_00207640 predicted 476
10 SASI_Rn02_00207641 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179165 predicted 212
2 SASI_Mm02_00321516 predicted 346
3 SASI_Mm02_00321517 predicted 236
4 SASI_Mm01_00179166 predicted 211
5 SASI_Mm01_00179168 predicted 343
6 SASI_Mm01_00179169 predicted 786
7 SASI_Mm01_00179170 predicted 435
8 SASI_Mm01_00179171 predicted 314
9 SASI_Mm01_00179172 predicted 394
10 SASI_Mm01_00179173 predicted 776
11 SASI_Mm01_00179167 predicted 595
12 SASI_Mm01_00179174 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006705
GADD45G MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-323s21c1
Sequence:CCGGCATCGCGCTGCAGATCCATTTCTCGAGAAATGGATCTGCAGCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-236s21c1
Sequence:CCGGCGTCTACGAGTCAGCCAAAGTCTCGAGACTTTGGCTGACTCGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-136s21c1
Sequence:CCGGAGGACACAGTTCCGGAAAGCACTCGAGTGCTTTCCGGAACTGTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-513s21c1
Sequence:CCGGTTGGAGAAGCTCAGCCTGTTTCTCGAGAAACAGGCTGAGCTTCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-179s21c1
Sequence:CCGGGAAAGCGCTGCATGAGTTGCTCTCGAGAGCAACTCATGCAGCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006705.3-789s21c1
Sequence:CCGGTGAGGACTCTGCAAGTGTCTGCTCGAGCAGACACTTGCAGAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006705.2-923s1c1
Sequence:CCGGGCCCTGGACTTGGTACAGTTTCTCGAGAAACTGTACCAAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-269s1c1
Sequence:CCGGCCCGACAATGTGACCTTCTGTCTCGAGACAGAAGGTCACATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-460s1c1
Sequence:CCGGGCACTGCATCCTCATTTCGAACTCGAGTTCGAAATGAGGATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-367s1c1
Sequence:CCGGCGAGAACGACATCGACATAGTCTCGAGACTATGTCGATGTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006705
GADD45G MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-323s21c1
Sequence:CCGGCATCGCGCTGCAGATCCATTTCTCGAGAAATGGATCTGCAGCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-236s21c1
Sequence:CCGGCGTCTACGAGTCAGCCAAAGTCTCGAGACTTTGGCTGACTCGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-136s21c1
Sequence:CCGGAGGACACAGTTCCGGAAAGCACTCGAGTGCTTTCCGGAACTGTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-513s21c1
Sequence:CCGGTTGGAGAAGCTCAGCCTGTTTCTCGAGAAACAGGCTGAGCTTCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-179s21c1
Sequence:CCGGGAAAGCGCTGCATGAGTTGCTCTCGAGAGCAACTCATGCAGCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006705.3-789s21c1
Sequence:CCGGTGAGGACTCTGCAAGTGTCTGCTCGAGCAGACACTTGCAGAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006705.2-923s1c1
Sequence:CCGGGCCCTGGACTTGGTACAGTTTCTCGAGAAACTGTACCAAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-269s1c1
Sequence:CCGGCCCGACAATGTGACCTTCTGTCTCGAGACAGAAGGTCACATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-460s1c1
Sequence:CCGGGCACTGCATCCTCATTTCGAACTCGAGTTCGAAATGAGGATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-367s1c1
Sequence:CCGGCGAGAACGACATCGACATAGTCTCGAGACTATGTCGATGTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006705
GADD45G MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-323s21c1
Sequence:CCGGCATCGCGCTGCAGATCCATTTCTCGAGAAATGGATCTGCAGCGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-236s21c1
Sequence:CCGGCGTCTACGAGTCAGCCAAAGTCTCGAGACTTTGGCTGACTCGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-136s21c1
Sequence:CCGGAGGACACAGTTCCGGAAAGCACTCGAGTGCTTTCCGGAACTGTGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-513s21c1
Sequence:CCGGTTGGAGAAGCTCAGCCTGTTTCTCGAGAAACAGGCTGAGCTTCTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006705.3-179s21c1
Sequence:CCGGGAAAGCGCTGCATGAGTTGCTCTCGAGAGCAACTCATGCAGCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006705.3-789s21c1
Sequence:CCGGTGAGGACTCTGCAAGTGTCTGCTCGAGCAGACACTTGCAGAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006705.2-923s1c1
Sequence:CCGGGCCCTGGACTTGGTACAGTTTCTCGAGAAACTGTACCAAGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-269s1c1
Sequence:CCGGCCCGACAATGTGACCTTCTGTCTCGAGACAGAAGGTCACATTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-460s1c1
Sequence:CCGGGCACTGCATCCTCATTTCGAACTCGAGTTCGAAATGAGGATGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006705.2-367s1c1
Sequence:CCGGCGAGAACGACATCGACATAGTCTCGAGACTATGTCGATGTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011817
VALIDATED
GADD45G MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011817.1-864s21c1
Sequence:CCGGCAAGCAGCCTTCCAGTGAAAGCTCGAGCTTTCACTGGAAGGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-451s21c1
Sequence:CCGGATCCTCATTTCGAATCCTAATCTCGAGATTAGGATTCGAAATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-344s21c1
Sequence:CCGGTCTGCTGTGAGAACGACATTGCTCGAGCAATGTCGTTCTCACAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-307s21c1
Sequence:CCGGATAGCGCTGCAGATCCATTTCCTCGAGGAAATGGATCTGCAGCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-242s21c1
Sequence:CCGGTGAATGTGGACCCTGACAATGCTCGAGCATTGTCAGGGTCCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011817.1-597s1c1
Sequence:CCGGGATCGACTTGGTGACACTCTACTCGAGTAGAGTGTCACCAAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-347s1c1
Sequence:CCGGGCTGTGAGAACGACATTGATACTCGAGTATCAATGTCGTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011817.1-316s1c1
Sequence:CCGGCAGATCCATTTCACGTTGATTCTCGAGAATCAACGTGAAATGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-450s1c1
Sequence:CCGGCATCCTCATTTCGAATCCTAACTCGAGTTAGGATTCGAAATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-461s1c1
Sequence:CCGGCGAATCCTAATGAGGACACATCTCGAGATGTGTCCTCATTAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011817
VALIDATED
GADD45G MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011817.1-864s21c1
Sequence:CCGGCAAGCAGCCTTCCAGTGAAAGCTCGAGCTTTCACTGGAAGGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-451s21c1
Sequence:CCGGATCCTCATTTCGAATCCTAATCTCGAGATTAGGATTCGAAATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-344s21c1
Sequence:CCGGTCTGCTGTGAGAACGACATTGCTCGAGCAATGTCGTTCTCACAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-307s21c1
Sequence:CCGGATAGCGCTGCAGATCCATTTCCTCGAGGAAATGGATCTGCAGCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-242s21c1
Sequence:CCGGTGAATGTGGACCCTGACAATGCTCGAGCATTGTCAGGGTCCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011817.1-597s1c1
Sequence:CCGGGATCGACTTGGTGACACTCTACTCGAGTAGAGTGTCACCAAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-347s1c1
Sequence:CCGGGCTGTGAGAACGACATTGATACTCGAGTATCAATGTCGTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011817.1-316s1c1
Sequence:CCGGCAGATCCATTTCACGTTGATTCTCGAGAATCAACGTGAAATGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-450s1c1
Sequence:CCGGCATCCTCATTTCGAATCCTAACTCGAGTTAGGATTCGAAATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-461s1c1
Sequence:CCGGCGAATCCTAATGAGGACACATCTCGAGATGTGTCCTCATTAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011817
VALIDATED
GADD45G MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011817.1-864s21c1
Sequence:CCGGCAAGCAGCCTTCCAGTGAAAGCTCGAGCTTTCACTGGAAGGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-451s21c1
Sequence:CCGGATCCTCATTTCGAATCCTAATCTCGAGATTAGGATTCGAAATGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-344s21c1
Sequence:CCGGTCTGCTGTGAGAACGACATTGCTCGAGCAATGTCGTTCTCACAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-307s21c1
Sequence:CCGGATAGCGCTGCAGATCCATTTCCTCGAGGAAATGGATCTGCAGCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011817.1-242s21c1
Sequence:CCGGTGAATGTGGACCCTGACAATGCTCGAGCATTGTCAGGGTCCACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011817.1-597s1c1
Sequence:CCGGGATCGACTTGGTGACACTCTACTCGAGTAGAGTGTCACCAAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-347s1c1
Sequence:CCGGGCTGTGAGAACGACATTGATACTCGAGTATCAATGTCGTTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011817.1-316s1c1
Sequence:CCGGCAGATCCATTTCACGTTGATTCTCGAGAATCAACGTGAAATGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-450s1c1
Sequence:CCGGCATCCTCATTTCGAATCCTAACTCGAGTTAGGATTCGAAATGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011817.1-461s1c1
Sequence:CCGGCGAATCCTAATGAGGACACATCTCGAGATGTGTCCTCATTAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks