EMAIL THIS PAGE TO A FRIEND

GADD45GIP1

growth arrest and DNA-damage-inducible, gamma interacting protein 1

59 Gene Product Result for
Synonyms: CKBBP2 CRIF1 PLINP PLINP-1 PRG6 Plinp1
UniProtKB ID: Q8TAE8, Q8IVM3, Q8TE51, Q969P9, Q9BSM6
Gene ID:
Human(90480) Summary: This gene encodes a nuclear-localized protein that may be induced by p53 and regulates the cell cycle by inhibiting G1 to S phase progression. The encoded protein may interact with other cell cycle regulators. [provided by RefSeq, Aug 2012]
Mouse(102060) growth arrest and DNA-damage-inducible, gamma interacting protein 1
Rat(288916) growth arrest and DNA-damage-inducible, gamma interacting protein 1
sheep(101104145) growth arrest and DNA-damage-inducible, gamma interacting protein 1
domestic guinea pig(100728137) growth arrest and DNA-damage-inducible, gamma interacting protein 1
naked mole-rat(101720902) growth arrest and DNA-damage-inducible, gamma interacting protein 1
Zebrafish(402803) growth arrest and DNA-damage-inducible, gamma interacting protein 1
dog(476693) growth arrest and DNA-damage-inducible, gamma interacting protein 1
cow(504718) growth arrest and DNA-damage-inducible, gamma interacting protein 1
domestic cat(101093836) growth arrest and DNA-damage-inducible, gamma interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052850 Rosetta Predictions human pricing
XM_001071308 Rosetta Predictions rat pricing
XM_213842 Rosetta Predictions rat pricing
NM_183358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182890 predicted 513
2 SASI_Hs01_00182891 predicted 507
3 SASI_Hs01_00182892 predicted 371
4 SASI_Hs01_00182893 predicted 450
5 SASI_Hs01_00182894 predicted 515
6 SASI_Hs02_00361537 predicted 373
7 SASI_Hs01_00182895 predicted 376
8 SASI_Hs01_00182896 predicted 682
9 SASI_Hs01_00182897 predicted 282
10 SASI_Hs01_00182898 predicted 187
11 SASI_Hs01_00182899 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334636 predicted 784
2 SASI_Rn02_00334637 predicted 603
3 SASI_Rn02_00334638 predicted 750
4 SASI_Rn02_00334639 predicted 627
5 SASI_Rn02_00334640 predicted 718
6 SASI_Rn02_00334641 predicted 760
7 SASI_Rn02_00334642 predicted 826
8 SASI_Rn02_00334643 predicted 770
9 SASI_Rn02_00334644 predicted 734
10 SASI_Rn02_00334645 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374956 predicted 786
2 SASI_Rn02_00374957 predicted 603
3 SASI_Rn02_00374958 predicted 753
4 SASI_Rn02_00374959 predicted 628
5 SASI_Rn02_00374960 predicted 725
6 SASI_Rn02_00374961 predicted 763
7 SASI_Rn02_00374962 predicted 826
8 SASI_Rn02_00374963 predicted 770
9 SASI_Rn02_00374964 predicted 731
10 SASI_Rn02_00374965 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176359 predicted 917
2 SASI_Mm01_00176361 predicted 696
3 SASI_Mm01_00176362 predicted 1125
4 SASI_Mm02_00350480 predicted 1132
5 SASI_Mm01_00176363 predicted 359
6 SASI_Mm01_00176364 predicted 1152
7 SASI_Mm01_00176365 predicted 386
8 SASI_Mm01_00176368 predicted 708
9 SASI_Mm02_00350481 predicted 1167
10 SASI_Mm02_00350482 predicted 994
11 SASI_Mm01_00176360 predicted 612
12 SASI_Mm01_00176366 predicted 1142
13 SASI_Mm01_00176367 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183358
VALIDATED
GADD45GIP1 MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, gamma interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183358.2-386s1c1
Sequence:CCGGGCCAAGATGCCACAAATGATTCTCGAGAATCATTTGTGGCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183358.2-914s1c1
Sequence:CCGGGCTTCTGTTTACCAACATTAACTCGAGTTAATGTTGGTAAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183358.2-877s1c1
Sequence:CCGGGCAAATAATGAAGGAGCAGATCTCGAGATCTGCTCCTTCATTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183358.2-575s1c1
Sequence:CCGGCGCCTAAAGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCTTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-525s21c1
Sequence:CCGGTGCTCGCTTCCAGGAACTATTCTCGAGAATAGTTCCTGGAAGCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-385s21c1
Sequence:CCGGGCCAAGATGCCACAAATGATTCTCGAGAATCATTTGTGGCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183358.3-574s21c1
Sequence:CCGGCGCCTAAAGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCTTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-599s21c1
Sequence:CCGGAGAAGAAGGAGGCACGAATTGCTCGAGCAATTCGTGCCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-700s21c1
Sequence:CCGGCAGCTGCTGACAACCCATATTCTCGAGAATATGGGTTGTCAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183358
VALIDATED
GADD45GIP1 MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, gamma interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183358.2-386s1c1
Sequence:CCGGGCCAAGATGCCACAAATGATTCTCGAGAATCATTTGTGGCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183358.2-914s1c1
Sequence:CCGGGCTTCTGTTTACCAACATTAACTCGAGTTAATGTTGGTAAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183358.2-877s1c1
Sequence:CCGGGCAAATAATGAAGGAGCAGATCTCGAGATCTGCTCCTTCATTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183358.2-575s1c1
Sequence:CCGGCGCCTAAAGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCTTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-525s21c1
Sequence:CCGGTGCTCGCTTCCAGGAACTATTCTCGAGAATAGTTCCTGGAAGCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-385s21c1
Sequence:CCGGGCCAAGATGCCACAAATGATTCTCGAGAATCATTTGTGGCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183358.3-574s21c1
Sequence:CCGGCGCCTAAAGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCTTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-599s21c1
Sequence:CCGGAGAAGAAGGAGGCACGAATTGCTCGAGCAATTCGTGCCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-700s21c1
Sequence:CCGGCAGCTGCTGACAACCCATATTCTCGAGAATATGGGTTGTCAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183358
VALIDATED
GADD45GIP1 MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, gamma interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183358.2-386s1c1
Sequence:CCGGGCCAAGATGCCACAAATGATTCTCGAGAATCATTTGTGGCATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183358.2-914s1c1
Sequence:CCGGGCTTCTGTTTACCAACATTAACTCGAGTTAATGTTGGTAAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183358.2-877s1c1
Sequence:CCGGGCAAATAATGAAGGAGCAGATCTCGAGATCTGCTCCTTCATTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183358.2-575s1c1
Sequence:CCGGCGCCTAAAGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCTTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-525s21c1
Sequence:CCGGTGCTCGCTTCCAGGAACTATTCTCGAGAATAGTTCCTGGAAGCGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-385s21c1
Sequence:CCGGGCCAAGATGCCACAAATGATTCTCGAGAATCATTTGTGGCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183358.3-574s21c1
Sequence:CCGGCGCCTAAAGGAAGAAAGACAACTCGAGTTGTCTTTCTTCCTTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-599s21c1
Sequence:CCGGAGAAGAAGGAGGCACGAATTGCTCGAGCAATTCGTGCCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322531    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_183358.3-700s21c1
Sequence:CCGGCAGCTGCTGACAACCCATATTCTCGAGAATATGGGTTGTCAGCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052850
VALIDATED
GADD45GIP1 MISSION shRNA Bacterial Glycerol Stock
growth arrest and DNA-damage-inducible, gamma interacting protein 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000241882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-405s21c1
Sequence:CCGGGATGCCACAGATGATTGTGAACTCGAGTTCACAATCATCTGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-282s21c1
Sequence:CCGGGGCCGAAGAACGCGAATGGTACTCGAGTACCATTCGCGTTCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-416s21c1
Sequence:CCGGTGATTGTGAACTGGCAGCAGCCTCGAGGCTGCTGCCAGTTCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-196s21c1
Sequence:CCGGGCTAAGCAGTTCGCGCGTTACCTCGAGGTAACGCGCGAACTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052850
VALIDATED
GADD45GIP1 MISSION shRNA shRNA Plasmid DNA
growth arrest and DNA-damage-inducible, gamma interacting protein 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000241882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-405s21c1
Sequence:CCGGGATGCCACAGATGATTGTGAACTCGAGTTCACAATCATCTGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-282s21c1
Sequence:CCGGGGCCGAAGAACGCGAATGGTACTCGAGTACCATTCGCGTTCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-416s21c1
Sequence:CCGGTGATTGTGAACTGGCAGCAGCCTCGAGGCTGCTGCCAGTTCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-196s21c1
Sequence:CCGGGCTAAGCAGTTCGCGCGTTACCTCGAGGTAACGCGCGAACTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052850
VALIDATED
GADD45GIP1 MISSION shRNA Lentiviral Transduction Particles
growth arrest and DNA-damage-inducible, gamma interacting protein 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000241882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-405s21c1
Sequence:CCGGGATGCCACAGATGATTGTGAACTCGAGTTCACAATCATCTGTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-282s21c1
Sequence:CCGGGGCCGAAGAACGCGAATGGTACTCGAGTACCATTCGCGTTCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-416s21c1
Sequence:CCGGTGATTGTGAACTGGCAGCAGCCTCGAGGCTGCTGCCAGTTCACAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_052850.2-196s21c1
Sequence:CCGGGCTAAGCAGTTCGCGCGTTACCTCGAGGTAACGCGCGAACTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks