EMAIL THIS PAGE TO A FRIEND

GADL1

glutamate decarboxylase-like 1

141 Gene Product Result for
UniProtKB ID: Q6ZQY3
Gene ID:
Mouse(73748) glutamate decarboxylase-like 1
Rat(367181) glutamate decarboxylase-like 1
chicken(100857134) glutamate decarboxylase-like 1
dog(485629) glutamate decarboxylase-like 1
domestic cat(101090963) glutamate decarboxylase-like 1
cow(614548) glutamate decarboxylase-like 1
Horse(100057562) glutamate decarboxylase-like 1
naked mole-rat(101705450) glutamate decarboxylase-like 1
domestic guinea pig(100712617) glutamate decarboxylase-like 1
sheep(101110627) glutamate decarboxylase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207359 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035641 MISSION® esiRNA esiRNA human GADL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207359 Rosetta Predictions human pricing
XM_001076997 Rosetta Predictions rat pricing
XM_345993 Rosetta Predictions rat pricing
XM_135211 Rosetta Predictions mouse pricing
XM_985562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091375 predicted 413
2 SASI_Hs01_00091376 predicted 282
3 SASI_Hs01_00091377 predicted 752
4 SASI_Hs01_00091378 predicted 871
5 SASI_Hs01_00091379 predicted 498
6 SASI_Hs01_00091380 predicted 1011
7 SASI_Hs01_00091381 predicted 684
8 SASI_Hs02_00373915 predicted 637
9 SASI_Hs01_00091382 predicted 673
10 SASI_Hs01_00091383 predicted 443
11 SASI_Hs01_00091384 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355352 predicted 1447
2 SASI_Rn02_00355353 predicted 1526
3 SASI_Rn02_00355354 predicted 380
4 SASI_Rn02_00355355 predicted 1602
5 SASI_Rn02_00355356 predicted 293
6 SASI_Rn02_00355357 predicted 1791
7 SASI_Rn02_00355358 predicted 1449
8 SASI_Rn02_00355359 predicted 1661
9 SASI_Rn02_00355360 predicted 845
10 SASI_Rn02_00355361 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142597 predicted 1223
2 SASI_Rn01_00142598 predicted 200
3 SASI_Rn01_00142599 predicted 1495
4 SASI_Rn01_00142600 predicted 487
5 SASI_Rn01_00142601 predicted 1141
6 SASI_Rn01_00142602 predicted 2595
7 SASI_Rn01_00142603 predicted 527
8 SASI_Rn01_00142604 predicted 2434
9 SASI_Rn01_00142605 predicted 1688
10 SASI_Rn01_00142606 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_135211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217236 predicted 496
2 SASI_Mm02_00424610 predicted 1299
3 SASI_Mm02_00424611 predicted 1248
4 SASI_Mm02_00424612 predicted 509
5 SASI_Mm02_00424613 predicted 733
6 SASI_Mm02_00424614 predicted 639
7 SASI_Mm02_00424615 predicted 439
8 SASI_Mm02_00424616 predicted 633
9 SASI_Mm02_00424617 predicted 650
10 SASI_Mm02_00424618 predicted 1511
11 SASI_Mm01_00217235 predicted 449
12 SASI_Mm01_00217237 predicted 401
13 SASI_Mm01_00217238 predicted 480
14 SASI_Mm01_00217239 predicted 389
15 SASI_Mm01_00217240 predicted 492
16 SASI_Mm01_00217241 predicted 236
17 SASI_Mm01_00217242 predicted 389
18 SASI_Mm01_00217243 predicted 238
19 SASI_Mm01_00217244 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448791 predicted 1210
2 SASI_Mm02_00448792 predicted 578
3 SASI_Mm02_00448793 predicted 1206
4 SASI_Mm02_00448794 predicted 1248
5 SASI_Mm02_00448795 predicted 589
6 SASI_Mm02_00448796 predicted 1423
7 SASI_Mm02_00448797 predicted 821
8 SASI_Mm02_00448798 predicted 725
9 SASI_Mm02_00448799 predicted 522
10 SASI_Mm02_00448800 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028638
GADL1 MISSION shRNA Bacterial Glycerol Stock
glutamate decarboxylase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-208s21c1
Sequence:CCGGTGAAAGCTACGGACGTCAATGCTCGAGCATTGACGTCCGTAGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-173s21c1
Sequence:CCGGAGAAGCCTGTAGGCTCATAATCTCGAGATTATGAGCCTACAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028638.1-1977s21c1
Sequence:CCGGTCAGCACCATCAGGGATTTACCTCGAGGTAAATCCCTGATGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-635s21c1
Sequence:CCGGGTCTGGTTTGCCAAGATTAATCTCGAGATTAATCTTGGCAAACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-424s21c1
Sequence:CCGGTTATAACAGAGGCGCTGAATCCTCGAGGATTCAGCGCCTCTGTTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028638
GADL1 MISSION shRNA shRNA Plasmid DNA
glutamate decarboxylase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-208s21c1
Sequence:CCGGTGAAAGCTACGGACGTCAATGCTCGAGCATTGACGTCCGTAGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-173s21c1
Sequence:CCGGAGAAGCCTGTAGGCTCATAATCTCGAGATTATGAGCCTACAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028638.1-1977s21c1
Sequence:CCGGTCAGCACCATCAGGGATTTACCTCGAGGTAAATCCCTGATGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-635s21c1
Sequence:CCGGGTCTGGTTTGCCAAGATTAATCTCGAGATTAATCTTGGCAAACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-424s21c1
Sequence:CCGGTTATAACAGAGGCGCTGAATCCTCGAGGATTCAGCGCCTCTGTTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028638
GADL1 MISSION shRNA Lentiviral Transduction Particles
glutamate decarboxylase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-208s21c1
Sequence:CCGGTGAAAGCTACGGACGTCAATGCTCGAGCATTGACGTCCGTAGCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-173s21c1
Sequence:CCGGAGAAGCCTGTAGGCTCATAATCTCGAGATTATGAGCCTACAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028638.1-1977s21c1
Sequence:CCGGTCAGCACCATCAGGGATTTACCTCGAGGTAAATCCCTGATGGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-635s21c1
Sequence:CCGGGTCTGGTTTGCCAAGATTAATCTCGAGATTAATCTTGGCAAACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028638.1-424s21c1
Sequence:CCGGTTATAACAGAGGCGCTGAATCCTCGAGGATTCAGCGCCTCTGTTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207359
GADL1 MISSION shRNA Bacterial Glycerol Stock
glutamate decarboxylase-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207359.1-1404s1c1
Sequence:CCGGCCCTGGACTATCAGCATCAAACTCGAGTTTGATGCTGATAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-695s1c1
Sequence:CCGGGAAAGAGTTAATCGTGCTCTTCTCGAGAAGAGCACGATTAACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-394s1c1
Sequence:CCGGCTCAGCTTTGATGTCGAGGAACTCGAGTTCCTCGACATCAAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-574s1c1
Sequence:CCGGGCAGGATAAATTCTATGATGTCTCGAGACATCATAGAATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-124s1c1
Sequence:CCGGAGAGTGTCATTACTCTATGAACTCGAGTTCATAGAGTAATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207359
GADL1 MISSION shRNA shRNA Plasmid DNA
glutamate decarboxylase-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207359.1-1404s1c1
Sequence:CCGGCCCTGGACTATCAGCATCAAACTCGAGTTTGATGCTGATAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-695s1c1
Sequence:CCGGGAAAGAGTTAATCGTGCTCTTCTCGAGAAGAGCACGATTAACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-394s1c1
Sequence:CCGGCTCAGCTTTGATGTCGAGGAACTCGAGTTCCTCGACATCAAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-574s1c1
Sequence:CCGGGCAGGATAAATTCTATGATGTCTCGAGACATCATAGAATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-124s1c1
Sequence:CCGGAGAGTGTCATTACTCTATGAACTCGAGTTCATAGAGTAATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207359
GADL1 MISSION shRNA Lentiviral Transduction Particles
glutamate decarboxylase-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207359.1-1404s1c1
Sequence:CCGGCCCTGGACTATCAGCATCAAACTCGAGTTTGATGCTGATAGTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-695s1c1
Sequence:CCGGGAAAGAGTTAATCGTGCTCTTCTCGAGAAGAGCACGATTAACTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-394s1c1
Sequence:CCGGCTCAGCTTTGATGTCGAGGAACTCGAGTTCCTCGACATCAAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-574s1c1
Sequence:CCGGGCAGGATAAATTCTATGATGTCTCGAGACATCATAGAATTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207359.1-124s1c1
Sequence:CCGGAGAGTGTCATTACTCTATGAACTCGAGTTCATAGAGTAATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks