EMAIL THIS PAGE TO A FRIEND

GAGE10

G antigen 10

8 Gene Product Result for
UniProtKB ID: A6NGK3
Gene ID:
sheep(101103873) G antigen 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098413 Rosetta Predictions human pricing
XM_927113 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318876 predicted 141
2 SASI_Hs02_00318877 predicted 143
3 SASI_Hs02_00318878 predicted 145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263113 predicted 121
2 SASI_Hs01_00263114 predicted 121
3 SASI_Hs01_00263115 predicted 114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098413
GAGE10 MISSION shRNA Bacterial Glycerol Stock
G antigen 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-173s21c1
Sequence:CCGGCCCTGAAATGATTGGGCCTATCTCGAGATAGGCCCAATCATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-144s21c1
Sequence:CCGGCGGTCTAGACCAAGACTCTATCTCGAGATAGAGTCTTGGTCTAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-343s21c1
Sequence:CCGGAGGAACAGGTTCACCCAAAGACTCGAGTCTTTGGGTGAACCTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-250s21c1
Sequence:CCGGCAGCAACTCAACGTCAGGATCCTCGAGGATCCTGACGTTGAGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-219s21c1
Sequence:CCGGGTGGAACCAGCAACACCTGAACTCGAGTTCAGGTGTTGCTGGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098413
GAGE10 MISSION shRNA shRNA Plasmid DNA
G antigen 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-173s21c1
Sequence:CCGGCCCTGAAATGATTGGGCCTATCTCGAGATAGGCCCAATCATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-144s21c1
Sequence:CCGGCGGTCTAGACCAAGACTCTATCTCGAGATAGAGTCTTGGTCTAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-343s21c1
Sequence:CCGGAGGAACAGGTTCACCCAAAGACTCGAGTCTTTGGGTGAACCTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-250s21c1
Sequence:CCGGCAGCAACTCAACGTCAGGATCCTCGAGGATCCTGACGTTGAGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-219s21c1
Sequence:CCGGGTGGAACCAGCAACACCTGAACTCGAGTTCAGGTGTTGCTGGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098413
GAGE10 MISSION shRNA Lentiviral Transduction Particles
G antigen 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-173s21c1
Sequence:CCGGCCCTGAAATGATTGGGCCTATCTCGAGATAGGCCCAATCATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-144s21c1
Sequence:CCGGCGGTCTAGACCAAGACTCTATCTCGAGATAGAGTCTTGGTCTAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-343s21c1
Sequence:CCGGAGGAACAGGTTCACCCAAAGACTCGAGTCTTTGGGTGAACCTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-250s21c1
Sequence:CCGGCAGCAACTCAACGTCAGGATCCTCGAGGATCCTGACGTTGAGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098413.2-219s21c1
Sequence:CCGGGTGGAACCAGCAACACCTGAACTCGAGTTCAGGTGTTGCTGGTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)