EMAIL THIS PAGE TO A FRIEND

GAGE12C

G antigen 12C

12 Gene Product Result for
Synonyms: GAGE-12B
Species: Human GAGE12C(729422)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098408 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318845 predicted 320
2 SASI_Hs02_00318846 predicted 193
3 SASI_Hs02_00318847 predicted 311
4 SASI_Hs02_00318848 predicted 197
5 SASI_Hs02_00318849 predicted 321
6 SASI_Hs02_00318850 predicted 247
7 SASI_Hs02_00318851 predicted 243
8 SASI_Hs02_00318852 predicted 249
9 SASI_Hs02_00318853 predicted 219
10 SASI_Hs02_00318854 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098408
GAGE12C MISSION shRNA Bacterial Glycerol Stock
G antigen 12C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-248s21c1
Sequence:CCGGGGAACCAGCAACTCAATGTCACTCGAGTGACATTGAGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-322s21c1
Sequence:CCGGGGCCGAAGCCTGAAGCTCATACTCGAGTATGAGCTTCAGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-170s21c1
Sequence:CCGGACAGCCTCCTGAAATGATTGGCTCGAGCCAATCATTTCAGGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-259s21c1
Sequence:CCGGCTCAATGTCAGGATCCTGCAGCTCGAGCTGCAGGATCCTGACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-378s21c1
Sequence:CCGGTGTGAAGATGGTCCTGATGGGCTCGAGCCCATCAGGACCATCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098408
GAGE12C MISSION shRNA shRNA Plasmid DNA
G antigen 12C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-248s21c1
Sequence:CCGGGGAACCAGCAACTCAATGTCACTCGAGTGACATTGAGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-322s21c1
Sequence:CCGGGGCCGAAGCCTGAAGCTCATACTCGAGTATGAGCTTCAGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-170s21c1
Sequence:CCGGACAGCCTCCTGAAATGATTGGCTCGAGCCAATCATTTCAGGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-259s21c1
Sequence:CCGGCTCAATGTCAGGATCCTGCAGCTCGAGCTGCAGGATCCTGACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-378s21c1
Sequence:CCGGTGTGAAGATGGTCCTGATGGGCTCGAGCCCATCAGGACCATCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098408
GAGE12C MISSION shRNA Lentiviral Transduction Particles
G antigen 12C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-248s21c1
Sequence:CCGGGGAACCAGCAACTCAATGTCACTCGAGTGACATTGAGTTGCTGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-322s21c1
Sequence:CCGGGGCCGAAGCCTGAAGCTCATACTCGAGTATGAGCTTCAGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-170s21c1
Sequence:CCGGACAGCCTCCTGAAATGATTGGCTCGAGCCAATCATTTCAGGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-259s21c1
Sequence:CCGGCTCAATGTCAGGATCCTGCAGCTCGAGCTGCAGGATCCTGACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098408.1-378s21c1
Sequence:CCGGTGTGAAGATGGTCCTGATGGGCTCGAGCCCATCAGGACCATCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks