EMAIL THIS PAGE TO A FRIEND

GAGE12E

G antigen 12E

13 Gene Product Result for
Synonyms: GAGE-12B
Species: Human GAGE12E(729431)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306209 ANTI-GAGE12B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098418 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318899 predicted 314
2 SASI_Hs02_00318900 predicted 199
3 SASI_Hs02_00318901 predicted 318
4 SASI_Hs02_00318902 predicted 204
5 SASI_Hs02_00318903 predicted 314
6 SASI_Hs02_00318904 predicted 250
7 SASI_Hs02_00318905 predicted 249
8 SASI_Hs02_00318906 predicted 256
9 SASI_Hs02_00318907 predicted 219
10 SASI_Hs02_00318908 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098418
GAGE12E MISSION shRNA Bacterial Glycerol Stock
G antigen 12E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-221s21c1
Sequence:CCGGAGTGGAACCAGCAACACCTGACTCGAGTCAGGTGTTGCTGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-332s21c1
Sequence:CCGGTGAAGCTCATAGCCAGGAACACTCGAGTGTTCCTGGCTATGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-247s21c1
Sequence:CCGGGGGAACCAGCAACTCAATGTCCTCGAGGACATTGAGTTGCTGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-165s21c1
Sequence:CCGGTATGTACAGCCTCCTGAAATGCTCGAGCATTTCAGGAGGCTGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-364s21c1
Sequence:CCGGAGACTGGGTGTGAGTGTGAAGCTCGAGCTTCACACTCACACCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098418
GAGE12E MISSION shRNA shRNA Plasmid DNA
G antigen 12E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-221s21c1
Sequence:CCGGAGTGGAACCAGCAACACCTGACTCGAGTCAGGTGTTGCTGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-332s21c1
Sequence:CCGGTGAAGCTCATAGCCAGGAACACTCGAGTGTTCCTGGCTATGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-247s21c1
Sequence:CCGGGGGAACCAGCAACTCAATGTCCTCGAGGACATTGAGTTGCTGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-165s21c1
Sequence:CCGGTATGTACAGCCTCCTGAAATGCTCGAGCATTTCAGGAGGCTGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-364s21c1
Sequence:CCGGAGACTGGGTGTGAGTGTGAAGCTCGAGCTTCACACTCACACCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098418
GAGE12E MISSION shRNA Lentiviral Transduction Particles
G antigen 12E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-221s21c1
Sequence:CCGGAGTGGAACCAGCAACACCTGACTCGAGTCAGGTGTTGCTGGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-332s21c1
Sequence:CCGGTGAAGCTCATAGCCAGGAACACTCGAGTGTTCCTGGCTATGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-247s21c1
Sequence:CCGGGGGAACCAGCAACTCAATGTCCTCGAGGACATTGAGTTGCTGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-165s21c1
Sequence:CCGGTATGTACAGCCTCCTGAAATGCTCGAGCATTTCAGGAGGCTGTACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098418.1-364s21c1
Sequence:CCGGAGACTGGGTGTGAGTGTGAAGCTCGAGCTTCACACTCACACCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks