EMAIL THIS PAGE TO A FRIEND

GAGE12F

G antigen 12F

9 Gene Product Result for
Species: Human GAGE12F(100008586)
UniProtKB ID: P0CL80, Q66I50
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098405 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318818 predicted 38
2 SASI_Hs02_00318819 predicted 45
3 SASI_Hs02_00318820 predicted 38
4 SASI_Hs02_00318821 predicted 27
5 SASI_Hs02_00318822 predicted 14
6 SASI_Hs02_00318823 predicted 10
7 SASI_Hs02_00318824 predicted 20
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098405
GAGE12F MISSION shRNA Bacterial Glycerol Stock
G antigen 12F
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-88s21c1
Sequence:CCGGGAGCAGTTCAGTGATGAAGTGCTCGAGCACTTCATCACTGAACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-36s21c1
Sequence:CCGGTAGACCAAGGCGCTATGTACACTCGAGTGTACATAGCGCCTTGGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-53s21c1
Sequence:CCGGTACAGCCTCCTGAAATGATTGCTCGAGCAATCATTTCAGGAGGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-107s21c1
Sequence:CCGGTGGAACCAGCAACACCTGAAGCTCGAGCTTCAGGTGTTGCTGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-133s21c1
Sequence:CCGGGAACCAGCAACTCAACGTCAGCTCGAGCTGACGTTGAGTTGCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098405
GAGE12F MISSION shRNA shRNA Plasmid DNA
G antigen 12F
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-88s21c1
Sequence:CCGGGAGCAGTTCAGTGATGAAGTGCTCGAGCACTTCATCACTGAACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-36s21c1
Sequence:CCGGTAGACCAAGGCGCTATGTACACTCGAGTGTACATAGCGCCTTGGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-53s21c1
Sequence:CCGGTACAGCCTCCTGAAATGATTGCTCGAGCAATCATTTCAGGAGGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-107s21c1
Sequence:CCGGTGGAACCAGCAACACCTGAAGCTCGAGCTTCAGGTGTTGCTGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-133s21c1
Sequence:CCGGGAACCAGCAACTCAACGTCAGCTCGAGCTGACGTTGAGTTGCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098405
GAGE12F MISSION shRNA Lentiviral Transduction Particles
G antigen 12F
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-88s21c1
Sequence:CCGGGAGCAGTTCAGTGATGAAGTGCTCGAGCACTTCATCACTGAACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-36s21c1
Sequence:CCGGTAGACCAAGGCGCTATGTACACTCGAGTGTACATAGCGCCTTGGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-53s21c1
Sequence:CCGGTACAGCCTCCTGAAATGATTGCTCGAGCAATCATTTCAGGAGGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-107s21c1
Sequence:CCGGTGGAACCAGCAACACCTGAAGCTCGAGCTTCAGGTGTTGCTGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098405.1-133s21c1
Sequence:CCGGGAACCAGCAACTCAACGTCAGCTCGAGCTGACGTTGAGTTGCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)