EMAIL THIS PAGE TO A FRIEND

GAGE12G

G antigen 12G

46 Gene Product Result for
Synonyms: AL4 CT4.7 GAGE-12G RP11-959H17.6
Species: Human GAGE12G(645073)
UniProtKB ID: P0CL81, Q66I50
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098409 Rosetta Predictions human pricing
XM_930039 Rosetta Predictions human pricing
XM_934217 Rosetta Predictions human pricing
XM_934222 Rosetta Predictions human pricing
XM_934225 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318855 predicted 319
2 SASI_Hs02_00318856 predicted 198
3 SASI_Hs02_00318857 predicted 311
4 SASI_Hs02_00318858 predicted 200
5 SASI_Hs02_00318859 predicted 204
6 SASI_Hs02_00318860 predicted 319
7 SASI_Hs02_00318861 predicted 253
8 SASI_Hs02_00318862 predicted 215
9 SASI_Hs02_00318863 predicted 199
10 SASI_Hs02_00318864 predicted 155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288483 predicted 560
2 SASI_Hs01_00288484 predicted 644
3 SASI_Hs01_00288485 predicted 615
4 SASI_Hs01_00288486 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253807 predicted 86
2 SASI_Hs01_00253808 predicted 321
3 SASI_Hs01_00253809 predicted 76
4 SASI_Hs01_00253810 predicted 79
5 SASI_Hs01_00253811 predicted 75
6 SASI_Hs01_00253812 predicted 90
7 SASI_Hs01_00253813 predicted 159
8 SASI_Hs01_00253814 predicted 144
9 SASI_Hs01_00253815 predicted 114
10 SASI_Hs01_00253816 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299494 predicted 155
2 SASI_Hs01_00299495 predicted 132
3 SASI_Hs01_00299496 predicted 397
4 SASI_Hs01_00299497 predicted 126
5 SASI_Hs01_00299498 predicted 130
6 SASI_Hs01_00299499 predicted 155
7 SASI_Hs01_00299500 predicted 162
8 SASI_Hs01_00299501 predicted 394
9 SASI_Hs01_00299502 predicted 147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287670 predicted 243
2 SASI_Hs01_00287671 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098409
GAGE12G MISSION shRNA Bacterial Glycerol Stock
G antigen 12G
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-256s21c1
Sequence:CCGGCAACTCAACGTCAGGATCCTGCTCGAGCAGGATCCTGACGTTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-149s21c1
Sequence:CCGGGCCTAGACCAAGGCGCTATGTCTCGAGACATAGCGCCTTGGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-162s21c1
Sequence:CCGGCGCTATGTACAGCCTCCTGAACTCGAGTTCAGGAGGCTGTACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-219s21c1
Sequence:CCGGGAAGTGGAACCAGCAACACCTCTCGAGAGGTGTTGCTGGTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098409
GAGE12G MISSION shRNA shRNA Plasmid DNA
G antigen 12G
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-256s21c1
Sequence:CCGGCAACTCAACGTCAGGATCCTGCTCGAGCAGGATCCTGACGTTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-149s21c1
Sequence:CCGGGCCTAGACCAAGGCGCTATGTCTCGAGACATAGCGCCTTGGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-162s21c1
Sequence:CCGGCGCTATGTACAGCCTCCTGAACTCGAGTTCAGGAGGCTGTACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-219s21c1
Sequence:CCGGGAAGTGGAACCAGCAACACCTCTCGAGAGGTGTTGCTGGTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098409
GAGE12G MISSION shRNA Lentiviral Transduction Particles
G antigen 12G
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-256s21c1
Sequence:CCGGCAACTCAACGTCAGGATCCTGCTCGAGCAGGATCCTGACGTTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-149s21c1
Sequence:CCGGGCCTAGACCAAGGCGCTATGTCTCGAGACATAGCGCCTTGGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-162s21c1
Sequence:CCGGCGCTATGTACAGCCTCCTGAACTCGAGTTCAGGAGGCTGTACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098409.1-219s21c1
Sequence:CCGGGAAGTGGAACCAGCAACACCTCTCGAGAGGTGTTGCTGGTTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks