EMAIL THIS PAGE TO A FRIEND

GAGE12H

G antigen 12H

9 Gene Product Result for
Synonyms: RP11-959H17.7
Species: Human GAGE12H(729442)
UniProtKB ID: A6NDE8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301795 ANTI-GAGE12H (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098410 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318865 predicted 156
2 SASI_Hs02_00318866 predicted 156
3 SASI_Hs02_00318867 predicted 158
4 SASI_Hs02_00318868 predicted 131
5 SASI_Hs02_00318869 predicted 124
6 SASI_Hs02_00318870 predicted 128
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098410
GAGE12H MISSION shRNA Bacterial Glycerol Stock
G antigen 12H
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-142s21c1
Sequence:CCGGATTATTGGCCTAGACCAAGGCCTCGAGGCCTTGGTCTAGGCCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-205s21c1
Sequence:CCGGAGCAGTTCAGTGATGAAGTGGCTCGAGCCACTTCATCACTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-249s21c1
Sequence:CCGGGAACCAGCAACTCAATGTCAGCTCGAGCTGACATTGAGTTGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-333s21c1
Sequence:CCGGGAAGCTCATAGCCAGGAACAGCTCGAGCTGTTCCTGGCTATGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-367s21c1
Sequence:CCGGCTGGGTGTGAGTGTGAAGATGCTCGAGCATCTTCACACTCACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-167s21c1
Sequence:CCGGTGTACAGCCTCCTGAAATGATCTCGAGATCATTTCAGGAGGCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-281s21c1
Sequence:CCGGTGCTCAGAAGGGAGAGGATGACTCGAGTCATCCTCTCCCTTCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098410
GAGE12H MISSION shRNA shRNA Plasmid DNA
G antigen 12H
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-142s21c1
Sequence:CCGGATTATTGGCCTAGACCAAGGCCTCGAGGCCTTGGTCTAGGCCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-205s21c1
Sequence:CCGGAGCAGTTCAGTGATGAAGTGGCTCGAGCCACTTCATCACTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-249s21c1
Sequence:CCGGGAACCAGCAACTCAATGTCAGCTCGAGCTGACATTGAGTTGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-333s21c1
Sequence:CCGGGAAGCTCATAGCCAGGAACAGCTCGAGCTGTTCCTGGCTATGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-367s21c1
Sequence:CCGGCTGGGTGTGAGTGTGAAGATGCTCGAGCATCTTCACACTCACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-167s21c1
Sequence:CCGGTGTACAGCCTCCTGAAATGATCTCGAGATCATTTCAGGAGGCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-281s21c1
Sequence:CCGGTGCTCAGAAGGGAGAGGATGACTCGAGTCATCCTCTCCCTTCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098410
GAGE12H MISSION shRNA Lentiviral Transduction Particles
G antigen 12H
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-142s21c1
Sequence:CCGGATTATTGGCCTAGACCAAGGCCTCGAGGCCTTGGTCTAGGCCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-205s21c1
Sequence:CCGGAGCAGTTCAGTGATGAAGTGGCTCGAGCCACTTCATCACTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-249s21c1
Sequence:CCGGGAACCAGCAACTCAATGTCAGCTCGAGCTGACATTGAGTTGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-333s21c1
Sequence:CCGGGAAGCTCATAGCCAGGAACAGCTCGAGCTGTTCCTGGCTATGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-367s21c1
Sequence:CCGGCTGGGTGTGAGTGTGAAGATGCTCGAGCATCTTCACACTCACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-167s21c1
Sequence:CCGGTGTACAGCCTCCTGAAATGATCTCGAGATCATTTCAGGAGGCTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098410.1-281s21c1
Sequence:CCGGTGCTCAGAAGGGAGAGGATGACTCGAGTCATCCTCTCCCTTCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks