EMAIL THIS PAGE TO A FRIEND

GAGE12I

G antigen 12I

27 Gene Product Result for
Synonyms: AL4 CT4.7 GAGE-7B GAGE7B
Species: Human GAGE12I(26748)
UniProtKB ID: P0CL82, Q66I50
Gene ID:
Human(26748) Summary: This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YYWPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301082 Anti-GAGE7 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001477 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331944 predicted 252
2 SASI_Hs02_00331945 predicted 258
3 SASI_Hs02_00331946 predicted 255
4 SASI_Hs01_00209090 predicted 99
5 SASI_Hs01_00209092 predicted 334
6 SASI_Hs02_00331947 predicted 134
7 SASI_Hs01_00209095 predicted 93
8 SASI_Hs02_00331948 predicted 314
9 SASI_Hs02_00331949 predicted 124
10 SASI_Hs02_00331950 predicted 296
11 SASI_Hs01_00209091 predicted 79
12 SASI_Hs01_00209093 predicted 70
13 SASI_Hs01_00209094 predicted 80
14 SASI_Hs01_00209096 predicted 102
15 SASI_Hs01_00209097 predicted 338
16 SASI_Hs01_00209098 predicted 89
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001477
GAGE12I MISSION shRNA Bacterial Glycerol Stock
G antigen 12I
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-351s21c1
Sequence:CCGGGCCAAATCCAGAGGAGGTGAACTCGAGTTCACCTCCTCTGGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-261s21c1
Sequence:CCGGGCCGAAGCCTGAAGCTCATAGCTCGAGCTATGAGCTTCAGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-337s21c1
Sequence:CCGGCAGGAGATGGACCCGCCAAATCTCGAGATTTGGCGGGTCCATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-151s21c1
Sequence:CCGGAGTGATGAAGTGGAACCAGCACTCGAGTGCTGGTTCCACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-229s21c1
Sequence:CCGGGGAGAGGATGAGGGAGCATCTCTCGAGAGATGCTCCCTCATCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-152s1c1
Sequence:CCGGGTGATGAAGTGGAACCAGCAACTCGAGTTGCTGGTTCCACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-106s1c1
Sequence:CCGGGTACAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-154s1c1
Sequence:CCGGGATGAAGTGGAACCAGCAACACTCGAGTGTTGCTGGTTCCACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001477
GAGE12I MISSION shRNA shRNA Plasmid DNA
G antigen 12I
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-351s21c1
Sequence:CCGGGCCAAATCCAGAGGAGGTGAACTCGAGTTCACCTCCTCTGGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-261s21c1
Sequence:CCGGGCCGAAGCCTGAAGCTCATAGCTCGAGCTATGAGCTTCAGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-337s21c1
Sequence:CCGGCAGGAGATGGACCCGCCAAATCTCGAGATTTGGCGGGTCCATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-151s21c1
Sequence:CCGGAGTGATGAAGTGGAACCAGCACTCGAGTGCTGGTTCCACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-229s21c1
Sequence:CCGGGGAGAGGATGAGGGAGCATCTCTCGAGAGATGCTCCCTCATCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-152s1c1
Sequence:CCGGGTGATGAAGTGGAACCAGCAACTCGAGTTGCTGGTTCCACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-106s1c1
Sequence:CCGGGTACAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-154s1c1
Sequence:CCGGGATGAAGTGGAACCAGCAACACTCGAGTGTTGCTGGTTCCACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001477
GAGE12I MISSION shRNA Lentiviral Transduction Particles
G antigen 12I
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-351s21c1
Sequence:CCGGGCCAAATCCAGAGGAGGTGAACTCGAGTTCACCTCCTCTGGATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-261s21c1
Sequence:CCGGGCCGAAGCCTGAAGCTCATAGCTCGAGCTATGAGCTTCAGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-337s21c1
Sequence:CCGGCAGGAGATGGACCCGCCAAATCTCGAGATTTGGCGGGTCCATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-151s21c1
Sequence:CCGGAGTGATGAAGTGGAACCAGCACTCGAGTGCTGGTTCCACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001477.1-229s21c1
Sequence:CCGGGGAGAGGATGAGGGAGCATCTCTCGAGAGATGCTCCCTCATCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-152s1c1
Sequence:CCGGGTGATGAAGTGGAACCAGCAACTCGAGTTGCTGGTTCCACTTCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-106s1c1
Sequence:CCGGGTACAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001477.1-154s1c1
Sequence:CCGGGATGAAGTGGAACCAGCAACACTCGAGTGTTGCTGGTTCCACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks