EMAIL THIS PAGE TO A FRIEND

GAGE12J

G antigen 12J

12 Gene Product Result for
Synonyms: GAGE11
Species: Human GAGE12J(729396)
UniProtKB ID: A6NER3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098406 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318825 predicted 196
2 SASI_Hs02_00318826 predicted 202
3 SASI_Hs02_00318827 predicted 194
4 SASI_Hs02_00318828 predicted 196
5 SASI_Hs02_00318829 predicted 245
6 SASI_Hs02_00318830 predicted 219
7 SASI_Hs02_00318831 predicted 154
8 SASI_Hs02_00318832 predicted 154
9 SASI_Hs02_00318833 predicted 141
10 SASI_Hs02_00318834 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098406
GAGE12J MISSION shRNA Bacterial Glycerol Stock
G antigen 12J
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-212s21c1
Sequence:CCGGCAGTGATGAAGTGGAACCAGCCTCGAGGCTGGTTCCACTTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-163s21c1
Sequence:CCGGCCTATGTACAGCCTCCTGAAACTCGAGTTTCAGGAGGCTGTACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-333s21c1
Sequence:CCGGGAAGCTGATAGCCAGGAACAGCTCGAGCTGTTCCTGGCTATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-258s21c1
Sequence:CCGGACTCAACGTCAGGATCCTGCACTCGAGTGCAGGATCCTGACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-150s21c1
Sequence:CCGGCCTAGACCAAGACCCTATGTACTCGAGTACATAGGGTCTTGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098406
GAGE12J MISSION shRNA shRNA Plasmid DNA
G antigen 12J
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-212s21c1
Sequence:CCGGCAGTGATGAAGTGGAACCAGCCTCGAGGCTGGTTCCACTTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-163s21c1
Sequence:CCGGCCTATGTACAGCCTCCTGAAACTCGAGTTTCAGGAGGCTGTACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-333s21c1
Sequence:CCGGGAAGCTGATAGCCAGGAACAGCTCGAGCTGTTCCTGGCTATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-258s21c1
Sequence:CCGGACTCAACGTCAGGATCCTGCACTCGAGTGCAGGATCCTGACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-150s21c1
Sequence:CCGGCCTAGACCAAGACCCTATGTACTCGAGTACATAGGGTCTTGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098406
GAGE12J MISSION shRNA Lentiviral Transduction Particles
G antigen 12J
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-212s21c1
Sequence:CCGGCAGTGATGAAGTGGAACCAGCCTCGAGGCTGGTTCCACTTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-163s21c1
Sequence:CCGGCCTATGTACAGCCTCCTGAAACTCGAGTTTCAGGAGGCTGTACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-333s21c1
Sequence:CCGGGAAGCTGATAGCCAGGAACAGCTCGAGCTGTTCCTGGCTATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-258s21c1
Sequence:CCGGACTCAACGTCAGGATCCTGCACTCGAGTGCAGGATCCTGACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098406.1-150s21c1
Sequence:CCGGCCTAGACCAAGACCCTATGTACTCGAGTACATAGGGTCTTGGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks