EMAIL THIS PAGE TO A FRIEND

GAGE13

G antigen 13

48 Gene Product Result for
Synonyms: GAGE12A
Species: Human GAGE13(645051)
UniProtKB ID: Q4V321
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306458 ANTI-GAGE13(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085441 Rosetta Predictions human pricing
XM_001713660 Rosetta Predictions human pricing
XM_930025 Rosetta Predictions human pricing
XM_934195 Rosetta Predictions human pricing
XM_934197 Rosetta Predictions human pricing
XM_934198 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317725 predicted 283
2 SASI_Hs02_00317726 predicted 282
3 SASI_Hs02_00317727 predicted 284
4 SASI_Hs02_00317728 predicted 219
5 SASI_Hs02_00317729 predicted 210
6 SASI_Hs02_00317730 predicted 215
7 SASI_Hs02_00317731 predicted 125
8 SASI_Hs02_00317732 predicted 365
9 SASI_Hs02_00317733 predicted 169
10 SASI_Hs02_00317734 predicted 122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392553 predicted 213
2 SASI_Hs02_00392554 predicted 209
3 SASI_Hs02_00392555 predicted 216
4 SASI_Hs02_00392556 predicted 128
5 SASI_Hs02_00392557 predicted 127
6 SASI_Hs02_00392558 predicted 128
7 SASI_Hs02_00392559 predicted 464
8 SASI_Hs02_00392560 predicted 100
9 SASI_Hs02_00392561 predicted 363
10 SASI_Hs02_00392562 predicted 99
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280524 predicted 560
2 SASI_Hs01_00280525 predicted 646
3 SASI_Hs01_00280526 predicted 618
4 SASI_Hs01_00280527 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273295 predicted 84
2 SASI_Hs01_00273296 predicted 329
3 SASI_Hs01_00273297 predicted 78
4 SASI_Hs01_00273298 predicted 73
5 SASI_Hs01_00273299 predicted 73
6 SASI_Hs01_00273300 predicted 83
7 SASI_Hs01_00273301 predicted 156
8 SASI_Hs01_00273302 predicted 136
9 SASI_Hs01_00273303 predicted 105
10 SASI_Hs01_00273304 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282055 predicted 160
2 SASI_Hs01_00282056 predicted 134
3 SASI_Hs01_00282057 predicted 394
4 SASI_Hs01_00282058 predicted 120
5 SASI_Hs01_00282059 predicted 134
6 SASI_Hs01_00282060 predicted 165
7 SASI_Hs01_00282061 predicted 154
8 SASI_Hs01_00282062 predicted 396
9 SASI_Hs01_00282063 predicted 151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276386 predicted 243
2 SASI_Hs01_00276387 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098412
GAGE13 MISSION shRNA Bacterial Glycerol Stock
G antigen 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-217s21c1
Sequence:CCGGACCAGCAACTCAATGTCAGGACTCGAGTCCTGACATTGAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-296s21c1
Sequence:CCGGCCTGAAGCTGATAGCCAGGAACTCGAGTTCCTGGCTATCAGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-134s21c1
Sequence:CCGGGTAGAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-119s21c1
Sequence:CCGGAGACCAAGACGCTACGTAGAGCTCGAGCTCTACGTAGCGTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-108s21c1
Sequence:CCGGATTATCGGCCTAGACCAAGACCTCGAGGTCTTGGTCTAGGCCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098412
GAGE13 MISSION shRNA shRNA Plasmid DNA
G antigen 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-217s21c1
Sequence:CCGGACCAGCAACTCAATGTCAGGACTCGAGTCCTGACATTGAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-296s21c1
Sequence:CCGGCCTGAAGCTGATAGCCAGGAACTCGAGTTCCTGGCTATCAGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-134s21c1
Sequence:CCGGGTAGAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-119s21c1
Sequence:CCGGAGACCAAGACGCTACGTAGAGCTCGAGCTCTACGTAGCGTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-108s21c1
Sequence:CCGGATTATCGGCCTAGACCAAGACCTCGAGGTCTTGGTCTAGGCCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098412
GAGE13 MISSION shRNA Lentiviral Transduction Particles
G antigen 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-217s21c1
Sequence:CCGGACCAGCAACTCAATGTCAGGACTCGAGTCCTGACATTGAGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-296s21c1
Sequence:CCGGCCTGAAGCTGATAGCCAGGAACTCGAGTTCCTGGCTATCAGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-134s21c1
Sequence:CCGGGTAGAGCCTCCTGAAATGATTCTCGAGAATCATTTCAGGAGGCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-119s21c1
Sequence:CCGGAGACCAAGACGCTACGTAGAGCTCGAGCTCTACGTAGCGTCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098412.1-108s21c1
Sequence:CCGGATTATCGGCCTAGACCAAGACCTCGAGGTCTTGGTCTAGGCCGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks