EMAIL THIS PAGE TO A FRIEND

GAGE1

G antigen 1

59 Gene Product Result for
Synonyms: CT4.1 GAGE-1
Species: Human GAGE1(2543)
UniProtKB ID: Q13065
Gene ID:
Human(2543) Summary: This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YRPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. Nothing is presently known about the function of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001468 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223201 MISSION® esiRNA esiRNA targeting human GAGE1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040663 Rosetta Predictions human pricing
NM_001468 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193750 predicted 474
2 SASI_Hs01_00193751 predicted 463
3 SASI_Hs01_00193743 predicted 162
4 SASI_Hs01_00193744 predicted 138
5 SASI_Hs01_00193745 predicted 124
6 SASI_Hs01_00193746 predicted 132
7 SASI_Hs01_00193747 predicted 163
8 SASI_Hs01_00193748 predicted 165
9 SASI_Hs01_00193749 predicted 151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331909 predicted 159
2 SASI_Hs02_00331910 predicted 517
3 SASI_Hs01_00023863 predicted 587
4 SASI_Hs02_00331911 predicted 557
5 SASI_Hs02_00331912 predicted 163
6 SASI_Hs02_00331913 predicted 517
7 SASI_Hs02_00331914 predicted 155
8 SASI_Hs02_00331915 predicted 571
9 SASI_Hs02_00331916 predicted 546
10 SASI_Hs01_00023864 predicted 618
11 SASI_Hs01_00023865 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001468
GAGE1 MISSION shRNA Bacterial Glycerol Stock
G antigen 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-370s1c1
Sequence:CCGGGAAGAAGAGATGAGGTCTCACCTCGAGGTGAGACCTCATCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001468.1-487s1c1
Sequence:CCGGGAGAGACCGTTTAGTTCCTATCTCGAGATAGGAACTAAACGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-136s1c1
Sequence:CCGGCAGTTCAGTGATGAAGTGGAACTCGAGTTCCACTTCATCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-367s1c1
Sequence:CCGGCCTGAAGAAGAGATGAGGTCTCTCGAGAGACCTCATCTCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-343s1c1
Sequence:CCGGCCAAATCCAGAGGAGGTGAAACTCGAGTTTCACCTCCTCTGGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-154s1c1
Sequence:CCGGGAACCAGCAACACCTGAAGAACTCGAGTTCTTCAGGTGTTGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-304s1c1
Sequence:CCGGGAGTGTGAAGATGGTCCTGATCTCGAGATCAGGACCATCTTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-104s1c1
Sequence:CCGGCTCCTGAAATGATTGGGCCTACTCGAGTAGGCCCAATCATTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-96s1c1
Sequence:CCGGCGTAGAGCCTCCTGAAATGATCTCGAGATCATTTCAGGAGGCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001468.1-468s1c1
Sequence:CCGGGACTGAAATATCAAATGGCGACTCGAGTCGCCATTTGATATTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001468.1-470s1c1
Sequence:CCGGCTGAAATATCAAATGGCGAGACTCGAGTCTCGCCATTTGATATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-132s1c1
Sequence:CCGGCGAGCAGTTCAGTGATGAAGTCTCGAGACTTCATCACTGAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001468
GAGE1 MISSION shRNA shRNA Plasmid DNA
G antigen 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-370s1c1
Sequence:CCGGGAAGAAGAGATGAGGTCTCACCTCGAGGTGAGACCTCATCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001468.1-487s1c1
Sequence:CCGGGAGAGACCGTTTAGTTCCTATCTCGAGATAGGAACTAAACGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-136s1c1
Sequence:CCGGCAGTTCAGTGATGAAGTGGAACTCGAGTTCCACTTCATCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-367s1c1
Sequence:CCGGCCTGAAGAAGAGATGAGGTCTCTCGAGAGACCTCATCTCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-343s1c1
Sequence:CCGGCCAAATCCAGAGGAGGTGAAACTCGAGTTTCACCTCCTCTGGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-154s1c1
Sequence:CCGGGAACCAGCAACACCTGAAGAACTCGAGTTCTTCAGGTGTTGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-304s1c1
Sequence:CCGGGAGTGTGAAGATGGTCCTGATCTCGAGATCAGGACCATCTTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-104s1c1
Sequence:CCGGCTCCTGAAATGATTGGGCCTACTCGAGTAGGCCCAATCATTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-96s1c1
Sequence:CCGGCGTAGAGCCTCCTGAAATGATCTCGAGATCATTTCAGGAGGCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001468.1-468s1c1
Sequence:CCGGGACTGAAATATCAAATGGCGACTCGAGTCGCCATTTGATATTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001468.1-470s1c1
Sequence:CCGGCTGAAATATCAAATGGCGAGACTCGAGTCTCGCCATTTGATATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-132s1c1
Sequence:CCGGCGAGCAGTTCAGTGATGAAGTCTCGAGACTTCATCACTGAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001468
GAGE1 MISSION shRNA Lentiviral Transduction Particles
G antigen 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-370s1c1
Sequence:CCGGGAAGAAGAGATGAGGTCTCACCTCGAGGTGAGACCTCATCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001468.1-487s1c1
Sequence:CCGGGAGAGACCGTTTAGTTCCTATCTCGAGATAGGAACTAAACGGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-136s1c1
Sequence:CCGGCAGTTCAGTGATGAAGTGGAACTCGAGTTCCACTTCATCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-367s1c1
Sequence:CCGGCCTGAAGAAGAGATGAGGTCTCTCGAGAGACCTCATCTCTTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-343s1c1
Sequence:CCGGCCAAATCCAGAGGAGGTGAAACTCGAGTTTCACCTCCTCTGGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-154s1c1
Sequence:CCGGGAACCAGCAACACCTGAAGAACTCGAGTTCTTCAGGTGTTGCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-304s1c1
Sequence:CCGGGAGTGTGAAGATGGTCCTGATCTCGAGATCAGGACCATCTTCACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001468.1-104s1c1
Sequence:CCGGCTCCTGAAATGATTGGGCCTACTCGAGTAGGCCCAATCATTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-96s1c1
Sequence:CCGGCGTAGAGCCTCCTGAAATGATCTCGAGATCATTTCAGGAGGCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001468.1-468s1c1
Sequence:CCGGGACTGAAATATCAAATGGCGACTCGAGTCGCCATTTGATATTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001468.1-470s1c1
Sequence:CCGGCTGAAATATCAAATGGCGAGACTCGAGTCTCGCCATTTGATATTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001468.1-132s1c1
Sequence:CCGGCGAGCAGTTCAGTGATGAAGTCTCGAGACTTCATCACTGAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks