EMAIL THIS PAGE TO A FRIEND

GAGE2A

G antigen 2A

15 Gene Product Result for
Synonyms: CT4.2 GAGE-2 GAGE-2A GAGE2
Species: Human GAGE2A(729447)
UniProtKB ID: Q6NT46
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127212 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328792 predicted 142
2 SASI_Hs02_00328793 predicted 138
3 SASI_Hs02_00328794 predicted 134
4 SASI_Hs02_00328795 predicted 118
5 SASI_Hs02_00328796 predicted 112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127212
GAGE2A MISSION shRNA Bacterial Glycerol Stock
G antigen 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-127s21c1
Sequence:CCGGGCCTAGACCAAGACGCTACGTCTCGAGACGTAGCGTCTTGGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-225s21c1
Sequence:CCGGGGGAACCAGCAACTCAACGTCCTCGAGGACGTTGAGTTGCTGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-237s21c1
Sequence:CCGGCTCAACGTCAGGATCCTGCAGCTCGAGCTGCAGGATCCTGACGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-355s21c1
Sequence:CCGGGTGTGAAGATGGTCCTGATGGCTCGAGCCATCAGGACCATCTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-378s21c1
Sequence:CCGGAGGAGATGGACCCGCCAAATCCTCGAGGATTTGGCGGGTCCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-309s21c1
Sequence:CCGGCTGAAGCTCATAGCCAGGAACCTCGAGGTTCCTGGCTATGAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-196s21c1
Sequence:CCGGTGAAGTGGAACCAGCAACACCCTCGAGGGTGTTGCTGGTTCCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-147s21c1
Sequence:CCGGTAGAGCCTCCTGAAATGATTGCTCGAGCAATCATTTCAGGAGGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127212
GAGE2A MISSION shRNA shRNA Plasmid DNA
G antigen 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-127s21c1
Sequence:CCGGGCCTAGACCAAGACGCTACGTCTCGAGACGTAGCGTCTTGGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-225s21c1
Sequence:CCGGGGGAACCAGCAACTCAACGTCCTCGAGGACGTTGAGTTGCTGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-237s21c1
Sequence:CCGGCTCAACGTCAGGATCCTGCAGCTCGAGCTGCAGGATCCTGACGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-355s21c1
Sequence:CCGGGTGTGAAGATGGTCCTGATGGCTCGAGCCATCAGGACCATCTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-378s21c1
Sequence:CCGGAGGAGATGGACCCGCCAAATCCTCGAGGATTTGGCGGGTCCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-309s21c1
Sequence:CCGGCTGAAGCTCATAGCCAGGAACCTCGAGGTTCCTGGCTATGAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-196s21c1
Sequence:CCGGTGAAGTGGAACCAGCAACACCCTCGAGGGTGTTGCTGGTTCCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-147s21c1
Sequence:CCGGTAGAGCCTCCTGAAATGATTGCTCGAGCAATCATTTCAGGAGGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127212
GAGE2A MISSION shRNA Lentiviral Transduction Particles
G antigen 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-127s21c1
Sequence:CCGGGCCTAGACCAAGACGCTACGTCTCGAGACGTAGCGTCTTGGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-225s21c1
Sequence:CCGGGGGAACCAGCAACTCAACGTCCTCGAGGACGTTGAGTTGCTGGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-237s21c1
Sequence:CCGGCTCAACGTCAGGATCCTGCAGCTCGAGCTGCAGGATCCTGACGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-355s21c1
Sequence:CCGGGTGTGAAGATGGTCCTGATGGCTCGAGCCATCAGGACCATCTTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-378s21c1
Sequence:CCGGAGGAGATGGACCCGCCAAATCCTCGAGGATTTGGCGGGTCCATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-309s21c1
Sequence:CCGGCTGAAGCTCATAGCCAGGAACCTCGAGGTTCCTGGCTATGAGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-196s21c1
Sequence:CCGGTGAAGTGGAACCAGCAACACCCTCGAGGGTGTTGCTGGTTCCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127212.1-147s21c1
Sequence:CCGGTAGAGCCTCCTGAAATGATTGCTCGAGCAATCATTTCAGGAGGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks