EMAIL THIS PAGE TO A FRIEND

GAGE2B

G antigen 2B

8 Gene Product Result for
Synonyms: GAGE-2B
Species: Human GAGE2B(645037)
UniProtKB ID: Q13066, C9K0W9, Q4V322
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098411 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231671 MISSION® esiRNA esiRNA targeting human GAGE2B human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318871 predicted 124
2 SASI_Hs02_00318872 predicted 123
3 SASI_Hs02_00318873 predicted 122
4 SASI_Hs02_00318874 predicted 97
5 SASI_Hs02_00318875 predicted 99
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098411
GAGE2B MISSION shRNA Bacterial Glycerol Stock
G antigen 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-116s21c1
Sequence:CCGGTAGACCAAGACGCTACGTAGACTCGAGTCTACGTAGCGTCTTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-326s21c1
Sequence:CCGGACAGACTGGGTGTGAGTGTGACTCGAGTCACACTCACACCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-218s21c1
Sequence:CCGGAGCAACTCAACGTCAGGATCCCTCGAGGGATCCTGACGTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-130s21c1
Sequence:CCGGACGTAGAGCCTCCTGAAATGACTCGAGTCATTTCAGGAGGCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-338s21c1
Sequence:CCGGTGAGTGTGAAGATGGTCCTGACTCGAGTCAGGACCATCTTCACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098411
GAGE2B MISSION shRNA shRNA Plasmid DNA
G antigen 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-116s21c1
Sequence:CCGGTAGACCAAGACGCTACGTAGACTCGAGTCTACGTAGCGTCTTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-326s21c1
Sequence:CCGGACAGACTGGGTGTGAGTGTGACTCGAGTCACACTCACACCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-218s21c1
Sequence:CCGGAGCAACTCAACGTCAGGATCCCTCGAGGGATCCTGACGTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-130s21c1
Sequence:CCGGACGTAGAGCCTCCTGAAATGACTCGAGTCATTTCAGGAGGCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-338s21c1
Sequence:CCGGTGAGTGTGAAGATGGTCCTGACTCGAGTCAGGACCATCTTCACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098411
GAGE2B MISSION shRNA Lentiviral Transduction Particles
G antigen 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-116s21c1
Sequence:CCGGTAGACCAAGACGCTACGTAGACTCGAGTCTACGTAGCGTCTTGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-326s21c1
Sequence:CCGGACAGACTGGGTGTGAGTGTGACTCGAGTCACACTCACACCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-218s21c1
Sequence:CCGGAGCAACTCAACGTCAGGATCCCTCGAGGGATCCTGACGTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-130s21c1
Sequence:CCGGACGTAGAGCCTCCTGAAATGACTCGAGTCATTTCAGGAGGCTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098411.3-338s21c1
Sequence:CCGGTGAGTGTGAAGATGGTCCTGACTCGAGTCAGGACCATCTTCACACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks