EMAIL THIS PAGE TO A FRIEND

GAGE2C

G antigen 2C

15 Gene Product Result for
Synonyms: CT4.2 GAGE-2 GAGE-2C GAGE2
Species: Human GAGE2C(2574)
Gene ID:
Human(2574) Summary: This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YRPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302712 ANTI-GAGE2B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001472 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231231 MISSION® esiRNA esiRNA targeting human GAGE2C human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001472 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331927 predicted 276
2 SASI_Hs02_00331928 predicted 280
3 SASI_Hs02_00331929 predicted 285
4 SASI_Hs02_00331930 predicted 208
5 SASI_Hs02_00331931 predicted 212
6 SASI_Hs02_00331932 predicted 211
7 SASI_Hs01_00073015 predicted 125
8 SASI_Hs01_00073016 predicted 119
9 SASI_Hs01_00073017 predicted 359
10 SASI_Hs01_00073018 predicted 123
11 SASI_Hs01_00073019 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001472
GAGE2C MISSION shRNA Bacterial Glycerol Stock
G antigen 2C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-332s21c1
Sequence:CCGGTGGGTGTGAGTGTGAAGATGGCTCGAGCCATCTTCACACTCACACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-225s21c1
Sequence:CCGGCAACGTCAGGATCCTGCAGCTCTCGAGAGCTGCAGGATCCTGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-257s21c1
Sequence:CCGGAGAGGATGAGGGAGCATCTGCCTCGAGGCAGATGCTCCCTCATCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-366s21c1
Sequence:CCGGGAGATGGACCCGCCAAATCCACTCGAGTGGATTTGGCGGGTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-294s21c1
Sequence:CCGGCCTGAAGCTCATAGCCAGGAACTCGAGTTCCTGGCTATGAGCTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-127s21c1
Sequence:CCGGGCTACGTAGAGCCTCCTGAAACTCGAGTTTCAGGAGGCTCTACGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-378s1c1
Sequence:CCGGCCAAATCCAGAGGAGGTGAAACTCGAGTTTCACCTCCTCTGGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-189s1c1
Sequence:CCGGGAACCAGCAACACCTGAAGAACTCGAGTTCTTCAGGTGTTGCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-180s1c1
Sequence:CCGGGATGAAGTGGAACCAGCAACACTCGAGTGTTGCTGGTTCCACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-170s1c1
Sequence:CCGGGCAGTTCAGTGATGAAGTGGACTCGAGTCCACTTCATCACTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001472
GAGE2C MISSION shRNA shRNA Plasmid DNA
G antigen 2C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-332s21c1
Sequence:CCGGTGGGTGTGAGTGTGAAGATGGCTCGAGCCATCTTCACACTCACACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-225s21c1
Sequence:CCGGCAACGTCAGGATCCTGCAGCTCTCGAGAGCTGCAGGATCCTGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-257s21c1
Sequence:CCGGAGAGGATGAGGGAGCATCTGCCTCGAGGCAGATGCTCCCTCATCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-366s21c1
Sequence:CCGGGAGATGGACCCGCCAAATCCACTCGAGTGGATTTGGCGGGTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-294s21c1
Sequence:CCGGCCTGAAGCTCATAGCCAGGAACTCGAGTTCCTGGCTATGAGCTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-127s21c1
Sequence:CCGGGCTACGTAGAGCCTCCTGAAACTCGAGTTTCAGGAGGCTCTACGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-378s1c1
Sequence:CCGGCCAAATCCAGAGGAGGTGAAACTCGAGTTTCACCTCCTCTGGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-189s1c1
Sequence:CCGGGAACCAGCAACACCTGAAGAACTCGAGTTCTTCAGGTGTTGCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-180s1c1
Sequence:CCGGGATGAAGTGGAACCAGCAACACTCGAGTGTTGCTGGTTCCACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-170s1c1
Sequence:CCGGGCAGTTCAGTGATGAAGTGGACTCGAGTCCACTTCATCACTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001472
GAGE2C MISSION shRNA Lentiviral Transduction Particles
G antigen 2C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-332s21c1
Sequence:CCGGTGGGTGTGAGTGTGAAGATGGCTCGAGCCATCTTCACACTCACACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-225s21c1
Sequence:CCGGCAACGTCAGGATCCTGCAGCTCTCGAGAGCTGCAGGATCCTGACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-257s21c1
Sequence:CCGGAGAGGATGAGGGAGCATCTGCCTCGAGGCAGATGCTCCCTCATCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-366s21c1
Sequence:CCGGGAGATGGACCCGCCAAATCCACTCGAGTGGATTTGGCGGGTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-294s21c1
Sequence:CCGGCCTGAAGCTCATAGCCAGGAACTCGAGTTCCTGGCTATGAGCTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001472.2-127s21c1
Sequence:CCGGGCTACGTAGAGCCTCCTGAAACTCGAGTTTCAGGAGGCTCTACGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-378s1c1
Sequence:CCGGCCAAATCCAGAGGAGGTGAAACTCGAGTTTCACCTCCTCTGGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-189s1c1
Sequence:CCGGGAACCAGCAACACCTGAAGAACTCGAGTTCTTCAGGTGTTGCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-180s1c1
Sequence:CCGGGATGAAGTGGAACCAGCAACACTCGAGTGTTGCTGGTTCCACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001472.1-170s1c1
Sequence:CCGGGCAGTTCAGTGATGAAGTGGACTCGAGTCCACTTCATCACTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)